360
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v38.n2.08 ISSN 2477-9407
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Recibido el 23-08-2019 . Aceptado el 26-10-2020.
*Autor de correspondencia. Correo electrónico:
lgonzalezpaz@gmail.com
Characterization of CRISPR genetic sequences
in microorganisms associated with infections in
shrimp (Litopenaeus vannamei)
Caracterización de secuencias genéticas CRISPR en
microorganismos asociados a infecciones en camarón
(Litopenaeus vannamei)
Caracterização de sequências genéticas CRISPR em
microrganismos associados a infecções em camarões
(Litopenaeus vannamei)
Ángel Parra
1
, Carla Lossada
4
, Aleivi Pérez
3
, Johnny
Navarrete
5
and Lenin González
1,2*
Departamento de Biología, Facultad Experimental de Ciencias. La Universidad del
Zulia.
1
Laboratorio de Genética y Biología Molecular. Email: (AP) angelparra115@
gmail.com, ; Email: (LG) lgonzalezpaz@gmail.com, .
2
Laboratorio de Citogenética.
3
Laboratorio de Microbiología General. Email: aleiviciencias@gmail.com, .
4
Laboratorio
de Caracterización Molecular y Biomolecular – Centro de Investigación y Tecnología de
los Materiales – Instituto Venezolano de Investigación Cientíca - Zulia. Sección 526.
Maracaibo, Venezuela. Email: lossadacarla@gmail.com, .
5
Escuela Superior Politécnica
Agropecuaria de Manabí Manuel Félix López, Sitio El Limón, Campus Politécnico
Calceta, Manabí, Ecuador. Email: jnava_57@hotmail.com, .
Abstract
In shrimp farming, the family of proteobacteria Vibrionaceae, especially
the species of the genus Vibrio, represent one of the main responsible for
infections in shrimp production (Litopenaeus vannamei), generating great
losses to this industry. Phagotherapy emerges as a novel alternative for the
control of said infections in substitution to the use of antibiotics, thanks to the
specic inhibitory activity of these viruses. However, it is necessary to take
into account the presence in prokaryotes of genetic sequences called clusters
of regularly interspaced short palindromic repeats (CRISPR) that act as an
immune system against invasion of external mobile genetic elements such
361
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
as phage or plasmids. Due to its characteristics, the CRISPR/Cas system is
used as a tool for gene editing. This study presents the comparative analysis
of 7 CRISPR loci found in 5 sequences of complete genomes, available
in the database of NCBI/GenBank, to determine the potential use of the
phage strategy in shrimp farming. The CRISPR systems corresponded to
types I-E, I-F and III-D. 53 % of the spacers (75/142) presented homology
with plasmids, while the remaining 47 % (67/142) showed homology with
bacteriophages, mostly non-typical Vibrio infective viruses. The use of phage
therapy is proposed as a treatment for infections caused by members of the
family Vibrionaceae in shrimp cultures, due to the low occurrence of CRISPR
systems in the species studied and the low immunity to their phages, thus
ensuring greater sensitivity.
Keywords: CRISPR-Cas systems, Vibrio, phagotherapy, bioinformatic
analysis.
Resumen
En el cultivo del camarón, la familia de las proteobacterias Vibrionaceae,
especialmente las especies del género Vibrio, representan uno de los principales
responsables de las infecciones en la producción de camarones (Litopenaeus
vannamei), generando grandes pérdidas a esta industria. La fagoterapia
surge como una alternativa novedosa para el control de dichas infecciones en
sustitución al uso de antibióticos, gracias a la actividad inhibitoria especica
de estos virus. Sin embargo, es necesario tomar en cuenta la presencia en
procariotas de secuencias genéticas denominadas repeticiones palindrómicas
cortas agrupadas y regularmente interespaciadas (CRISPR) que actúan como
sistema inmune contra la invasión de elementos genéticos móviles externos
como fagos o plásmidos. Dadas sus características, el sistema CRISPR/Cas
se emplea como herramienta para la edición de genes. En este estudio se
presenta el análisis comparativo de 7 loci CRISPR encontrados en 5 secuencias
de genomas completos, disponibles en la base de datos del NCBI/GenBank,
para determinar la potencialidad del empleo de la estrategia fágica en
camaronicultura. Los sistemas CRISPR correspondieron a los tipos I-E, I-F y
III-D. El 53 % de los espaciadores (75/142) presentó homología con plásmidos,
mientras que el 47 % restante (67/142) mostró homología con bacteriófagos,
en su mayoría virus no típicos infectivos de Vibrio. Se propone el uso de la
fagoterapia como tratamiento de infecciones causadas por miembros de la
familia Vibrionaceae en cultivos de camarón debido a la baja ocurrencia de
sistemas CRISPR en las especies estudiadas y la baja inmunidad a sus fagos,
asegurando así una mayor sensibilidad.
Palabras clave: sistemas CRISPR-Cas, Vibrio, fagoterapia, análisis
bioinformático.
362
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
Introducción
En el cultivo de camarón
(Litopenaeus vannamei), la familia
de proteobacterias Vibrionaceae, el
género Vibrio, representa uno de
los principales responsables de las
infecciones con alta inuencia en
la producción larvaria asociadas al
cultivo de camarón. Estas bacterias
Gram-negativas son ubicuas y
están ampliamente distribuidas en
ambientes acuáticos, desde agua
salobre hasta aguas profundas, en
asociación con animales marinos,
algas y detritos. Los Vibrios también
Resumo
Na criação de camarões, a família das proteobacteria Vibrionaceae,
especialmente as espécies agrupadas no género Vibrio, representam uma das
principais responsáveis por infecções na produção de camarão (Litopenaeus
vannamei), gerando grandes prejuízos a esta indústria. A terapia fágica surge
como uma nova alternativa para o controle dessas infecções em substituição
ao uso de antibióticos, graças à atividade inibitória especíca desses vírus.
No entanto, é necessário levar em consideração a presença em procariotos de
sequências genéticas denominadas repetições palindrômicas curtas agrupadas
e regularmente espaçadas (CRISPR) que atuam como um sistema imunológico
contra a invasão de elementos genéticos móveis externos, como fagos ou
plasmídeos. Pelas suas características, o sistema CRISPR / Cas é utilizado como
ferramenta de edição de genes. Este estudo apresenta a análise comparativa de
7 locos CRISPR encontrados em 5 sequências de genomas completos, disponíveis
no banco de dados do NCBI/GenBank, para determinar o potencial de utilização
da estratégia de fagos na carcinicultura. Os sistemas CRISPR corresponderam
aos tipos I-E, I-F e III-D. 53 % dos espaçadores (75/142) mostraram homologia
com plasmídeos, enquanto os restantes 47 % (67/142) mostraram homologia com
bacteriófagos, principalmente vírus infecciosos Vibrio não típicos. A utilização da
terapia fágica é proposta como tratamento para infecções causadas por membros
da família Vibrionaceae em cultivo de camarão devido à baixa ocorrência de
sistemas CRISPR nas espécies estudadas e à baixa imunidade aos seus fagos,
garantindo assim maior sensibilidade.
Palavras chave: sistemas CRISPR-Cas, Vibrio, fagoterapia, análise
bioinformática.
Introduction
In shrimp culture, the family of
proteobacteria Vibrionaceae, those
of the genus Vibrio, represent one of
the main responsible for the infections
with a high inuence on larval
production associated with shrimp
culture (Litopenaeus vannamei).
These Gram-negative bacteria are
ubiquitous and widely distributed
in aquatic environments, from
brackish water to deep sea water,
in association with marine animals,
algae and detritus. Vibrios are also
present in estuarine and marine
363
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
aquatic ecosystems where shrimp are
naturally found and/or cultivated.
Bacteria of this genus are considered
part of the normal microbiota of
shrimp, constituting the highest
percentage of all bacteria isolated
from the digestive tract, gills, cuticle
and occasionally in the hemolymph.
However, under conditions of stress
or imbalance in the natural bacterial
microbiota these bacteria can induce
the development of infections in
organisms such as vibriosis (or
bacterial shrimp septicemia) (Cheng et
al., 2008; Aguirre et al., 2010; Yooseph
et al., 2010).
Of the genus Vibrio, the main
virulent strains of shrimp identied
in various larval stages are V.
alginolyticus, V. anguillarum, V.
parahaemolyticus, V. harveyi and
V. vulnicus (Kalatzis et al., 2018),
generating high mortalities, economic
losses in the production; they also cause
public health problems in humans due
to the consumption of derived marine
products contaminated with these
opportunistic pathogens (Cheng et al.,
2008; Won and Park, 2008; Aguirre et
al., 2010; Alagappan et al., 2010). The
prevention and control of diseases in
shrimp farming is based primarily
on the use of antibiotics (Lomelí
and Martínez, 2014), however, the
growing emergence of bacterial strains
resistant to antibiotics, added to the
concern induced by the prospect of
not having effective antibiotics in the
near future, has prompted the search
for new antagonistic alternatives
toward those that have not yet
developed mechanisms of resistance,
with fewer side effects, and with high
están presentes en ecosistemas
acuáticos estuarinos y marinos donde
los camarones se encuentran y/o
cultivan naturalmente. Las bacterias
de este género se consideran parte de
la microbiota normal del camarón,
constituyendo el porcentaje más alto
de todas las bacterias aisladas del
tracto digestivo, branquias, cutículas
y ocasionalmente en la hemolinfa.
Sin embargo, en condiciones de estrés
o desequilibrio en la microbiota
bacteriana natural, estas bacterias
pueden inducir el desarrollo de
infecciones en organismos como la
vibriosis (o septicemia bacteriana del
camarón) (Cheng et al., 2008; Aguirre
et al., 2010; Yooseph et al., 2010).
Del género Vibrio, las principales
cepas virulentas de camarón
identicadas en varios estadios
larvales son V. alginolyticus, V.
anguillarum, V. parahaemolyticus, V.
harveyi y V. vulnicus (Kalatzis et al.,
2018), generando altas mortalidades,
pérdidas económicas en la producción;
también causan problemas de
salud pública en humanos debido
al consumo de productos marinos
derivados contaminados con estos
patógenos oportunistas (Cheng
et al., 2008; Won y Park, 2008;
Aguirre et al., 2010; Alagappan et
al., 2010). La prevención y control de
enfermedades en la camaronicultura
se basa principalmente en el uso de
antibióticos (Lomelí y Martínez, 2014),
sin embargo, la creciente aparición de
cepas bacterianas resistentes a los
antibióticos, sumado a la preocupación
inducida por la perspectiva de no
contar con antibióticos efectivos. en
un futuro próximo, ha impulsado la
364
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
specicity, to avoid the disturbance
of the intestinal microbiota of the
human being and guarantee a greater
effectiveness of the treatments (Rice
and Stokes, 2008).
One of the promising strategies
on the way to the objective of nding
more effective, less toxic and specic
antagonists to control microorganisms
that cause infections, is represented
by the viruses that exclusively infect
the bacteria, called bacteriophages,
and their enzymatic derivatives
(enzybiotics). These are inhibitory
agents that have been described as
potential antimicrobial agents with
therapeutic interest (São, 2018),
including their application in shrimp
farming (Oliveira et al., 2012; Kalatzis
et al., 2018).
Although it is not clear if there
is any mechanism of bacterial
resistance against enzybiotics
(phage lysins), studies on the
use of phages as an alternative
treatment or biological control
show the opposite, and currently
a large number of investigations
are carried out in group of genomic
sequences present in several
prokaryotic microorganisms
known as “Clustered Regularly
Interspaced Short Palindromic
Repeats” (CRISPR), which have
shown a distinctive characteristic
of most genomes of bacteria and
archaea, that endows resistance
against bacteriophages (Horvath
and Barrangou, 2010; Kalatzis et
al., 2018).
In addition to the fact that
research on the presence of
CRISPRs has focused mainly on
búsqueda de nuevas alternativas
antagónicas hacia aquellas que aún
no han desarrollado mecanismos
de resistencia, con menores efectos
secundarios, y con alta especicidad,
para evitar la alteración de la
microbiota intestinal del ser humano
y garantizar una mayor efectividad de
los tratamientos (Rice y Stokes, 2008).
Una de las estrategias
prometedoras en el camino hacia el
objetivo de encontrar antagonistas más
ecaces, menos tóxicos y especícos
para el control de los microorganismos
causantes de infecciones, está
representada por los virus que infectan
exclusivamente a las bacterias,
llamados bacteriófagos, y sus
derivados enzimáticos (enzibióticos).
Se trata de agentes inhibidores que
han sido descritos como potenciales
agentes antimicrobianos con interés
terapéutico (São, 2018), incluida su
aplicación en el cultivo de camarón
(Oliveira et al., 2012; Kalatzis et al.,
2018).
Aunque no está claro si existe algún
mecanismo de resistencia bacteriana
frente a enzibióticos (fago lisinas), los
estudios sobre el uso de fagos como
tratamiento alternativo o control
biológico muestran lo contrario, y
actualmente se realizan un gran
número de investigaciones en grupo
de secuencias genómicas presentes en
varios microorganismos procarióticos
conocidos como “Repeticiones
palindrómicas cortas agrupadas
regularmente interespaciadas”
(CRISPR), que han mostrado una
distintiva característica en la mayoría
de los genomas de bacterias y arqueas,
que coneren resistencia contra
365
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
bacteria of clinical interest, while
little is known about the dynamics of
CRISPR in organisms of commercial
importance (Lyons et al., 2015),
the objective of this study, was to
perform a comparative analysis of
CRISPR Systems in genomes of
microorganisms with pathogenic
inuence on shrimp Litopenaeus
vannamei.
Materials and methods
Genomic sequences and
identication of CRISPR
structures
Five species of Vibrio were
studied: Vibrio alginolyticus, V.
anguillarum, V. parahaemolyticus,
V. harveyi, V. vulnicus and the
species Photobacterium damselae, all
associated with systemic infections
in shrimp, such as vibriosis, of
which a total of 1104 genomes were
obtained according to the database
of the NCBI (National Center for
Biotechnology Information, http://
www.ncbi.nlm.nih.gov/, Benson et
al., 2008). Draft genome sequences
were obtained from specic web
sites that are compiled in the Entrez
Genome project list (http://www.ncbi.
nlm.nih.gov/genomes/lproks.cgi) or
in the Genomes OnLine Database
(http://www.genomesonline.org/)
(Bernal et al., 2001), 69 of the
sequences correspond to complete
genomic sequences including 14 V.
alginolyticus, 13 V. anguillarum, 21
V. parahaemolyticus, 4 V. harveyi,
15 V. vulnicus, as well as 2
complete chromosomal sequences of
Photobacterium damselae (Table 1).
bacteriófagos (Horvath y Barrangou,
2010; Kalatzis et al., 2018).
Además de que la investigación
sobre la presencia de CRISPRs se ha
centrado principalmente en bacterias
de interés clínico, mientras que se
conoce poco sobre la dinámica de
CRISPR en organismos de importancia
comercial (Lyons et al., 2015), el
objetivo de este estudio, consistió
en realizar un análisis comparativo
de Sistemas CRISPR en genomas
de microorganismos con inuencia
patógena en camarón Litopenaeus
vannamei.
Materiales y métodos
Secuencias genómicas e
identicación de estructuras
CRISPR
Se estudiaron cinco especies
de Vibrio: Vibrio alginolyticus, V.
anguillarum, V. parahaemolyticus,
V. harveyi, V. vulnicus y la especie
Photobacterium damselae, todas
asociadas a infecciones sistémicas
en camarones, como la vibriosis, de
las cuales un total de 1104 genomas
se obtuvieron de acuerdo con la base
de datos del NCBI (Centro Nacional
de Información Biotecnológica, http://
www.ncbi.nlm.nih.gov/, Benson et al.,
2008). Las secuencias preliminares
del genoma se obtuvieron de sitios web
especícos que se compilan en la lista de
proyectos Entrez Genome (http://www.
ncbi.nlm.nih.gov/genomes/lproks.
cgi) o en la base de datos Genomes
OnLine (http://www.genomesonline.
org/) (Bernal et al., 2001), 69 de las
secuencias corresponden a secuencias
genómicas completas, que incluyen 14
366
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
CRISPR loci
Species
Accession num-
ber GenBank
Length of
CRISPR (pb)
Start End
Spacer
number
Length of
Spacer (pb)
DR
number
Length of
DR (pb)
DR Consensus
CRISPR
Type
Cas
gene
Ref.
Vp.
FORC_022
CP013248.1 /
P013249.1
1707 826587 828294 28 32 29 28 GTTAACTGCCACACAGGCAGCTTAGAAA I-F 6
Vh. ATCC
43516
CP014038.2 /
P014039.2
2287 73377 75664 37 32-33 38 29 GTGTTCTCCGTACCCACGGAGATGAACCG I-E 8
Vv. YJ016
BA000037.2 /
A000038.2
661 1694586 1695247 9 33-37 10 35
GTTTCAGACATGCCCGGTTTAGACGG-
GATTAAGAC
III-D 7
Chen et
al., 2003
Vv. 93U204
CP009261.1 /
P009262.1
3328 511712 515040 55 32 56 28 GTTCACTGCCGTATAGGCAGCTTAGAAA I-F 6
Lo et al.,
2014
256 2123187 2123443 3 43 4 32
GATATTTCTAACTGGGATACTTCCAAT-
GTAAA
Pd. KC-
Na-1*
CP021151.1 /
P021152.1
447 246163 246610 7 32 8 28 CTTCACTGCCGAGTAGGCAGCTTAGAAA I-F 6
29 257070 257278 3 31 4 29 CTTCACTGCCGAGTAGGCAGCTTAGAAAT
Vp. FORC_022, Vh. ATCC 43516, Vv. YJ016 y 93U204, Pd. KC-Na-1, are the abbreviations of V. parahaemolyticus FORC_022, V. harveyi ATCC 43516,
V. vulnicus YJ016 y 93U204, and P. damselae KC-Na-1, respectively; *, before classied in V. damselae; CRISPR, Clustered Regularly Interspaced Short
Palindromic Repeats; DR, direct repeats; Cas, CRISPR-associated (cas) gene cluster.
Vp. FORC_022, Vh. ATCC 43516, Vv. YJ016 y 93U204, Pd. KC-Na-1, son las abreviaturas de V. parahaemolyticus FORC_022, V. harveyi ATCC 43516, V.
vulnicus YJ016 y 93U204, y P. damselae KC-Na-1, respectivamente; *, antes clasicado en V. damselae; CRISPR, repeticiones palindrómicas cortas agrupadas
regularmente interespaciadas; DR, repeticiones directas; Cas, grupo de genes asociados a CRISPR (cas).
Table 1. CRISPR/Cas systems in Vibrionaceae genomes.
Cuadro 1. Sistemas CRISPR / Cas en genomas de Vibrionaceae.
367
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
For published genome sequences,
C
RISPR loci were obtained from the
CRISPRdb database (Grissa et al.,
2007a). Alternatively, the CRISPR
loci in the genomes were identied
by CRISPRFinder (Grissa et al.,
2007b). For this, two search criteria
were followed. One of them was the
screening of possible CRISPR locations
by detecting maximum repetitions
(repetition with the maximum possible
extension to the right or left without
incurring a mismatch) by using the
VMatch package, which is the REPuter
update (Kurtz and Schleiermacher,
1999) based on an efcient
implementation of improved sufx
arrays (Abouelhoda, 2004). The default
parameters used were the following: a
repetition length of 23 to 55 bp, a gap
size between repetitions of 25 to 60 bp,
a 20% mismatch of nucleotides between
repetitions. The other search criterion
was based on the CRISPR function
determination, for which lters are
added to help validate a CRISPR, such
as the search for non-identical spacers
with a size that should be from 0,6*
to 2,5* the size of the repetition. This
lter is congured to eliminate tandem
repeats. The comparison of the spacers
was made by aligning them (using
the default parameters of the Muscle
program). The percentage of similarity
of the spacers is calculated with the
percentage_identity function of the
(Bio)perl interface (AlignIO methods,
Muscle interface), a parameter set to
60 %.
To discriminate between conrmed
CRISPR structures from those
questionable, small structures similar
to CRISPR, that is, having only two
V. alginolyticus, 13 V. anguillarum,
21 V. parahaemolyticus, 4 V.
harveyi, 15 V. vulnicus, así como 2
secuencias cromosómicas completas
de Photobacterium damselae (Cuadro
1).
Las secuencias genómicas públicas
de los loci CRISPR se obtuvieron de
la base de datos CRISPRdb (Grissa
et al., 2007a). Alternativamente, los
loci CRISPR en los genomas fueron
identicados por CRISPRFinder
(Grissa et al., 2007b). Para ello se
siguieron dos criterios de búsqueda.
Uno de ellos fue el cribado de posibles
ubicaciones de CRISPR mediante la
detección de repeticiones máximas
(repetición con la máxima extensión
posible a la derecha o izquierda sin
incurrir en un desajuste) mediante
el uso del paquete VMatch, que es la
actualización de REPuter (Kurtz y
Schleiermacher, 1999) basada en una
implementación eciente de arreglos de
sujos mejorados (Abouelhoda, 2004).
Los parámetros predeterminados
utilizados fueron los siguientes: una
longitud de repetición de 23 a 55 pb, un
tamaño de espacio entre repeticiones
de 25 a 60 pb, un 20% de desajuste
de nucleótidos entre repeticiones. El
otro criterio de búsqueda se basó en la
determinación de la función CRISPR,
para lo cual se agregan ltros para
ayudar a validar un CRISPR, como la
búsqueda de espaciadores no idénticos
con un tamaño que debe ser de 0,6
* a 2,5 * el tamaño de la repetición.
Este ltro está congurado para
eliminar repeticiones en tándem.
La comparación de los espaciadores
se realizó alineándolos (utilizando
los parámetros predeterminados del
368
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
or three repeated sequences or direct
repeats (DR), are classied using a
level of Evidence, rated from 1 to 4,
where 1 includes small CRISPR (with
3 or fewer spacers) and 2 to 4 are
classied based on the repetition and
similarity of the spacer. This is because
questionable CRISPR structures
often tend to be byproducts of the
CRISPRFinder identication that are
not true CRISPR. Further, the tests
to verify the internal preservation
of the candidate repetitions and
the divergence of the candidate
spacers offered by CRISPRFinder are
considered.
Bioinformatic analysis and
statistical results
For the search of genes cas, the
rst step consisted in the identication
of open reading frames (ORF) with
Prodigal (Hyatt, 2010). Then these ORFs
were analyzed by the MacSyFinder
program by the models for the search of
HMM genes (Hidden Markov Models) in
a library of known Cas proteins (Abby,
2014). BLAST was used to identify the cas
genes in the upstream and downstream
sequences of the CRISPR and TIGRFAM
loci (Horvath et al., 2009). The cas type
and subtype were found through the
analysis of cas conglomerates, thanks
to the CRISPRCas-Finder program
(Grissa et al., 2007b). The unique spacer
sequences as well as their origin were
identied by NCBI’s multiple sequence
alignment program with predetermined
arguments. All spacers were compared
with the GenBank database to nd
homologous sequences with matches
of ≥85% (minimum of 28/33 coincident
nucleotides) (Horvath et al., 2009; Shen
et al., 2017).
programa Muscle). El porcentaje de
similitud de los espaciadores se calcula
con la función percent_identity de la
interfaz (Bio) perl (métodos AlignIO,
interfaz Muscle), un parámetro
establecido en 60%.
Para discriminar entre estructuras
CRISPR conrmadas de aquellas
cuestionables, las estructuras
pequeñas similares a CRISPR, es
decir, que tienen solo dos o tres
secuencias repetidas o repeticiones
directas (DR), se clasican utilizando
un nivel de evidencia, calicado de 1 a
4, donde 1 incluye pequeños CRISPR
(con 3 o menos espaciadores) y 2 a 4 se
clasican en función de la repetición
y similitud del espaciador. Esto se
debe a que las estructuras CRISPR
cuestionables a menudo tienden a ser
subproductos de la identicación de
CRISPRFinder que no son CRISPR
verdadero. Además, se consideran las
pruebas para vericar la preservación
interna de las repeticiones
candidatas y la divergencia de los
espaciadores candidatos ofrecidos por
CRISPRFinder.
Análisis bioinformático y
resultados estadísticos
Para la búsqueda de genes
cas, el primer paso consistió en
la identicación de marcos de
lectura abiertos (ORF) con Prodigal
(Hyatt, 2010). Luego, estos ORF
fueron analizados por el programa
MacSyFinder mediante los modelos
para la búsqueda de genes HMM
(Hidden Markov Models) en una
biblioteca de proteínas Cas conocidas
(Abby, 2014). BLAST se usó para
identicar los genes cas en las
secuencias aguas arriba y aguas
369
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
Phylogenetic trees were generated
based on the unweighted pair group
method (UPGMA) for the core protein
Cas, specically Cas1 using the
MUSCLE algorithm (Tamura et al.,
2013). In parallel, multiple sequence
alignments and phylogenetic analyzes
were performed using Clustal X, and
dendograms were visualized with the
accompanying application NJ Plot
(Larkin et al., 2007). The distance
matrix was calculated using the
Jaccard coefcient. The structure of
Cas proteins was evaluated by multiple
sequence alignments with Geneious
global alignment (Needleman-Wunsch)
with predetermined arguments (Shen
et al., 2017). The PubMLST database
was used for the determination of
the multilocus sequences and the
sequence typing data were used for the
goeBURST analysis (Shen et al., 2017).
The one-factor analysis of variance
(ANOVA) was used as a statistical
model to establish differences between
the comparative parameters analyzed.
Results and discussion
The present study aims to offer
an analysis of CRISPR/Cas gene
sequences in microorganisms of high
inuence in aquaculture production
associated with shrimp infections,
specically in the species of commercial
interest L. vannamei, intending to
offer alternatives for the control of
pathogens of bacterial origin, through
phagotherapy, a promising technology
for shrimp farming based on the
management of specic lytic phages
of bacteria or their lytic enzymes
(enzybiotics).
abajo de los loci CRISPR y TIGRFAM
(Horvath et al., 2009). El tipo y
subtipo cas se encontraron mediante
el análisis de conglomerados cas,
gracias al programa CRISPRCas-
Finder (Grissa et al., 2007b). Las
secuencias espaciadoras únicas, así
como su origen, fueron identicadas
por el programa de alineación de
secuencias múltiples del NCBI con
argumentos predeterminados. Todos
los espaciadores se compararon
con la base de datos GenBank para
encontrar secuencias homólogas
con coincidencias de ≥85% (mínimo
de 28/33 nucleótidos coincidentes)
(Horvath et al., 2009; Shen et al.,
2017).
Los árboles logenéticos se
generaron con base en el método
de grupos de pares no ponderados
(UPGMA) para la proteína central
Cas, especícamente Cas1, utilizando
el algoritmo MUSCLE (Tamura et
al., 2013). En paralelo, se realizaron
múltiples alineamientos de secuencia
y análisis logenéticos utilizando
Clustal X, y los dendogramas se
visualizaron con la aplicación adjunta
NJ Plot (Larkin et al., 2007). La matriz
de distancias se calculó mediante el
coeciente de Jaccard. La estructura
de las proteínas Cas se evaluó
mediante múltiples alineamientos
de secuencia con alineamiento global
Geneious (Needleman-Wunsch) con
argumentos predeterminados (Shen et
al., 2017). La base de datos PubMLST
se utilizó para la determinación de las
secuencias multilocus y los datos de
tipicación de secuencias se utilizaron
para el análisis goeBURST (Shen et
al., 2017). El análisis de varianza de
370
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
Organization and diversity of
CRISPR/Cas systems in Vibrionaceae
genome
Seven CRISPR structures were found
in 5 genomes within the total (1104
genomes) of the family of proteobacteria
Vibrionaceae studied, distributed in
3 Vibrio species (V. parahaemolyticus
FORC_022, V. harveyi ATCC 43516,
V. vulnicus YJ016 and 93U204) and
in the related species Photobacterium
damselae KC-Na-1 (formerly classied
as V. damselae) whose characteristics
are described in Table 1. Three different
CRISPR/Cas arrays in Vibrio that have
different locations on the chromosomes
were detected (Figure 1).
Figure 1. Architecture loci and gene organization of CRISPR systems in three different
regions. A, type I-F; B, type I-E; C, type III-D. The black diamonds represent the
CRISPR loci, and the white arrows (with lines in different directions) represent
the different cas genes found. The relative position on the chromosome is indicated
below each gene.
Figura 1. Loci de la Arquitectura y Organización genética de sistemas CRISPR en
tres regiones diferentes. A, tipo I-F; B, tipo I-E; C, tipo III-D. Los diamantes
negros representan los loci CRISPR y las echas blancas (con líneas en diferentes
direcciones) representan los diferentes genes cas encontrados. La posición relativa
en el cromosoma se indica debajo de cada gen.
un factor (ANOVA) se utilizó como
modelo estadístico para establecer
diferencias entre los parámetros
comparativos analizados.
Resultados y discusión
El presente estudio tiene como
objetivo ofrecer un análisis de
secuencias de genes CRISPR/
Cas en microorganismos de alta
inuencia en la producción acuícola
asociados a infecciones del camarón,
especícamente en la especie de
interés comercial L.vannamei, con
la intención de ofrecer alternativas
para el control de patógenos de origen
371
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
The types of CRISPR/Cas systems
found correspond to types I-E, I-F and
III-D. According to the relative location
on the chromosome, the CRISPR
loci were designated CRISPR1 and
CRISPR2. To better distinguish the
CRISPR/Cas system in the genus Vibrio,
or in the members with CRISPR matrices
found in the Vibrionaceae family, a
phylogenetic tree was constructed based
on the homology of the Cas1 proteins of
each species (Figure 2).
Figure 2. Phylogenetic tree for Cas1 proteins in the family Vibrionaceae. The UPGMA
tree of the Cas1 protein was generated using the MUSCLE algorithm in MEGA6.
The Cas1 proteins representative of the subtypes found were selected (I-F, I-E
and III-D) (A). Percentage identity of Cas1 proteins in the Vibrionaceae genomes
studied. (B). Vp. FORC_022, Vh. ATCC 43516, Vv. YJ016 and 93U204, Pd. KC-
Na-1, are the abbreviations of V. parahaemolyticus FORC_022, V. harveyi ATCC
43516, V. vulnicus YJ016 and 93U204, and P. damselae KC-Na-1, respectively.
Figura 2. Árbol logenético de las proteínas Cas1 de la familia Vibrionaceae. El árbol
UPGMA de la proteína Cas1 se generó utilizando el algoritmo MUSCLE en MEGA6.
Se seleccionaron las proteínas Cas1 representativas de los subtipos encontrados (I-
F, I-E y III-D) (A). Porcentaje de identidad de las proteínas Cas1 en los genomas
de Vibrionaceae estudiados. (B). Vp. FORC_022, Vh. ATCC 43516, Vv. YJ016 y
93U204, Pd. KC-Na-1, son las abreviaturas de V. parahaemolyticus FORC_022,
V. harveyi ATCC 43516, V. vulnicus YJ016 y 93U204, y P. damselae KC-Na-1,
respectivamente.
bacteriano. , a través de la fagoterapia,
una tecnología prometedora para
el cultivo de camarón basada en el
manejo de fagos líticos especícos
de bacterias o sus enzimas líticas
(enzibióticos).
Organización y diversidad
de sistemas CRISPR / Cas en el
genoma de Vibrionaceae
Se encontraron siete estructuras
CRISPR en 5 genomas dentro del
total (1104 genomas) de la familia
372
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
However, it is important to note
that since few conrmed CRISPR
sequences have been obtained in the
genomes of interest to date, this may
make it difcult to establish a more
adequate phylogenetic relationship,
so our results represent only a
limited approximation of the
relationship based only on the
conservation of Cas1, and can be
seen as an internal control of the
previous classication performed
by the CRISPRdb database and the
CRISPRFinder (Grissa et al., 2007a,
b). We recommend performing a
phylogenetic analysis with a greater
number of genomic sequences
(including partial genomes) and
that include CRISPR systems
with different levels of condence
to obtain a better discriminatory
phylogenetic relationship. The
distinction between the type of
CRISPR found by the analysis of
direct repeat (DR) sequence was
also evaluated (Figure 3). Typical
CRISPR matrices were observed
with a minimum of 4 to a maximum
of 56 DR, which had a length
between 28-35 bp. The DR were
therefore found to be interspaced,
with a minimum of 3 to a maximum
of 55 spacer sequences of a similar
length between 31-43 bp. Despite
the fact that most of the spacer
sequences presented a size of 32 bp,
the analysis of variance indicates
that there is no statistically
signicant difference (p> 0.01) that
allows to point out that the obtained
means corresponding to the number
and size of the spacer sequences are
different from each other.
de proteobacterias Vibrionaceae
estudiadas, distribuidas en 3 especies
de Vibrio (V. parahaemolyticus
FORC_022, V. harveyi ATCC 43516,
V. vulnicus YJ016 y 93U204) y en la
especie relacionada Photobacterium
damselae KC-Na-1 (anteriormente
clasicada como V. damselae) cuyas
características se describen en la
Tabla 1. Se detectaron tres matrices
CRISPR/Cas diferentes en Vibrio que
tienen diferentes ubicaciones en los
cromosomas (Figura 1).
Los tipos de sistemas CRISPR/Cas
encontrados corresponden a los tipos
I-E, I-F y III-D. Según la ubicación
relativa en el cromosoma, los loci
CRISPR se denominaron CRISPR1
y CRISPR2. Para distinguir mejor
el sistema CRISPR/Cas en el género
Vibrio, o en los miembros con matrices
CRISPR encontradas en la familia
Vibrionaceae, se construyó un árbol
logenético basado en la homología
de las proteínas Cas1 de cada especie
(Figura 2).
Sin embargo, es importante
señalar que dado que hasta la fecha
se han obtenido pocas secuencias
CRISPR conrmadas en los genomas
de interés, esto puede dicultar el
establecimiento de una relación
logenética más adecuada, por lo
que nuestros resultados representan
solo una aproximación limitada de
la relación basada únicamente sobre
la conservación de Cas1, y puede
verse como un control interno de
la clasicación anterior realizada
por la base de datos CRISPRdb y
el CRISPRFinder (Grissa et al.,
2007a, b). Recomendamos realizar
un análisis logenético con un mayor
373
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
However, there is a very low
correlation between the number and
size presented by these sequences
(Figure 4). The total number of
spacers detected per type of CRISPR
was 96/142 for types I-F (68 %), 37/142
for type I-E (26 %) and 9/142 for type
III-D (6 %). The observed CRISPR
structures exhibited between 6 to 8
genes associated with the CRISPR
sequences (cas) (Table 1).
The presence of I-F subtypes
corresponds to what has been
described in the literature in strains of
the genus such as V. cholerae O1/O139,
in which, after bioinformatic analysis,
CRISPR/Cas modules containing
Figure 3. Conservation of direct repetitions (DR) (A) the logo of the sequence was
created by WebLogo 3.6.0, and the comparative analysis of the CRISPR
repeats (B and C). Seven repeated CRISPR sequences were aligned using
ClustalX (Horvath et al., 2009) or generated using the MUSCLE algorithm in
MEGA6. Vp. FORC_022, Vh. ATCC 43516, Vv. YJ016 and 93U204, Pd. KC-Na-1,
are the abbreviations of V. parahaemolyticus FORC_022, V. harveyi ATCC 43516,
V. vulnicus YJ016 and 93U204, and P. damselae KC-Na-1, respectively.
Figura 3. Conservación de repeticiones directas (DR) (A) el logo de la secuencia fue
creado por WebLogo 3.6.0, y el análisis comparativo de las repeticiones
CRISPR (B y C). Se alinearon siete secuencias CRISPR repetidas usando
ClustalX (Horvath et al., 2009) o se generaron usando el algoritmo MUSCLE en
MEGA6. Vp. FORC_022, Vh. ATCC 43516, Vv. YJ016 y 93U204, Pd. KC-Na-1, son
las abreviaturas de V. parahaemolyticus FORC_022, V. harveyi ATCC 43516, V.
vulnicus YJ016 y 93U204, y P. damselae KC-Na-1, respectivamente.
número de secuencias genómicas
(incluyendo genomas parciales)
y que incluyan sistemas CRISPR
con diferentes niveles de conanza
para obtener una mejor relación
logenética discriminatoria. También
se evaluó la distinción entre el tipo de
CRISPR encontrado por el análisis de
secuencia de repetición directa (DR)
(Figura 3). Se observaron matrices
CRISPR típicas con un mínimo de 4
a un máximo de 56 DR, que tenían
una longitud entre 28-35 pb. Por lo
tanto, se encontró que las DR estaban
interespaciadas, con un mínimo de
3 a un máximo de 55 secuencias
espaciadoras de una longitud
374
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
the genes encoding the Cas1, Cas3
proteins have been identied and
Cas6, and based on the sequences of
proteins and their organization, have
been grouped in CRISPR/Cas systems
of type I-F (Labbate et al., 2016),
as well as in clinical isolates of the
species V. parahaemolyticus in which
the I-F CRISPR/Cas subtype has been
described (Sun et al., 2015). Likewise,
the presence of I-E subtypes has been
reported in strains of the genus such
as V. cholerae O395, in which 3 cas
core genes (cas1, cas2 and cas3) and
5 specic genes of the I-E subtype
(cse1, cse2, cse3, cse4, cas5e) have been
identied (Chakraborty et al., 2009;
Box et al., 2016).
Figure 4. Correlation of the number of spacers in the CRISPR loci and the size of the
CRISPR (bp) spacers found. A very low negative correlation was found (≤30%)
(A). Variability of the size of the CRISPR spacers and their number (p>0.05). The
x-axis represents the size of a CRISPR spacer, in nucleotides. The y-axis represents
the number of CRISPR spacing sequences of a given size (B).
Figura 4. Correlación del número de espaciadores en los loci CRISPR y el tamaño
de los espaciadores CRISPR (bp) encontrados. Se encontró una correlación
negativa muy baja (≤ 30%) (A). Variabilidad del tamaño de los espaciadores CRISPR
y su número (p> 0,05). El eje X representa el tamaño de un espaciador CRISPR, en
nucleótidos. El eje Y representa el número de secuencias de espaciado CRISPR de
un tamaño dado (B).
similar entre 31 y 43 pb. A pesar de
que la mayoría de las secuencias
espaciadoras presentaron un tamaño
de 32 pb, el análisis de varianza
indica que no existe una diferencia
estadísticamente signicativa (p>
0.01) que permita señalar que las
medias obtenidas correspondientes al
número y tamaño de las secuencias
espaciadoras son diferentes entre sí.
Sin embargo, existe una
correlación muy baja entre el número
y el tamaño que presentan estas
secuencias (Figura 4). El número
total de espaciadores detectados por
tipo de CRISPR fue 96/142 para los
tipos I-F (68%), 37/142 para el tipo I-E
(26%) y 9/142 para el tipo III-D (6%).
375
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
On the other hand, it has been
reported that CRISPR Type I-E
systems always have two loci pairs, at
least that is what has been evidenced
in enterobacteria genomes (Shen et
al., 2017). However, our results differ
from the aforementioned, since in
the species V. harveyi ATCC 43516
only, a conrmed CRISPR structure
was detected, such as that described
in strains such as V. cholerae O395
(Chakraborty et al., 2009).
Interestingly, a new form of
disposition of cas genes was found
for the Type III-D subtype detected
in V. vulnicus YJ016. Although
according to the current classication
model (Makarova et al., 2015),
it should still be a CRISPR/Cas
type III-D system because the cas
genes found are within the subtype
arrangement III-D, however, a pair
of cas2 genes was detected as well
as the cas1 gene at chromosomal
location 1693776-1694069 bp and
1691704 bp, respectively. This does
not correspond to the genes of subtype
III-D, and rather, they remind us of
the arrangement of the subtype III-A
architectures, which possess both the
cas10 and csm3 genes of type III-D,
and a cas nucleus represented by the
cas1 and cas2 (Makarova et al., 2015),
therefore it is in the presence of two
very closely related subtypes, and
with a possible common origin.
The origin of CRISPR spacers
Of the 130/142 (92 %) unique
spacer sequences found in the CRISPR
loci detected, it is important to note
that all had homology with some
sequence contained in the GenBank
database, as well as a great diversity
Las estructuras CRISPR observadas
exhibieron entre 6 y 8 genes asociados
con las secuencias CRISPR (cas)
(Cuadro 1).
La presencia de subtipos I-F
corresponde a lo descrito en la
literatura en cepas del género como
V. cholerae O1/O139, en las que,
tras análisis bioinformático, se han
estudiado módulos CRISPR/Cas que
contienen los genes que codican las
proteínas Cas1, Cas3. identicados y
Cas6, y en base a las secuencias de
proteínas y su organización, se han
agrupado en sistemas CRISPR/Cas
de tipo IF (Labbate et al., 2016), como
en aislados clínicos de la especie V.
parahaemolyticus en la que el subtipo
CRISPR/Cas I-F si se ha descrito
(Sun et al., 2015). Asimismo, se ha
reportado la presencia de subtipos
de I-E en cepas del género como V.
cholerae O395, en el que 3 genes del
núcleo cas (cas1, cas2 y cas3) y 5 genes
especícos del subtipo I-E (cse1, cse2,
cse3, cse4, cas5e) han sido identicados
(Chakraborty et al., 2009; Box et al.,
2016).
Por otro lado, se ha reportado que
los sistemas CRISPR tipo I-E siempre
tienen dos pares de loci, al menos
eso es lo que se ha evidenciado en
genomas de enterobacterias (Shen
et al., 2017). Sin embargo, nuestros
resultados dieren de los anteriores,
ya que en la especie V. harveyi ATCC
43516 únicamente se detectó una
estructura CRISPR conrmada, como
la descrita en cepas como V. cholerae
O395 (Chakraborty et al., 2009).
Curiosamente, se encontró una
nueva forma de disposición de genes
cas para el subtipo III-D detectado
376
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
in relation to the presented homology
to related or not sequences with the
family of proteobacteria Vibrionaceae.
53 % of the spacers (75/142) presented
homology with extrachromosomal
genetic material, while the remaining
47 % of the spacer sequences
(67/142) exhibited homology with
bacteriophages (Figure 5). Results that
indicate a clear immunity function
against foreign genetic material
(plasmids or phages) and a high
specicity of the different CRISPR/Cas
systems studied. The type of CRISPR
that gathered the greatest number
of spacer sequences was the I-F type
present in the species P. damselae
KC-Na-1, V. parahaemolyticus
FORC_022 and V. vulnicus 93U204,
who exhibited 10/96 (10.4 %), 28/96
(29.2 %) and 58/96 (60.4 %) spacer
sequences respectively. In types I-E
and III-D found in species V. harveyi
ATCC 43516 and V. vulnicus YJ016
respectively, were observed 37 and
9 corresponding spacer sequences
(Figure 5).
It is important to note that
the spacer sequences found in the
CRISPR type I-E were the ones that
presented a greater homology to
bacteriophage sequences with 76 %
(28/37) followed by type III-D with
56 % (5/9) and in smaller proportion,
the I-F type with 35 % (34/96).
Interestingly, on the contrary, the
spacers found in type I-F exhibited
the highest homology to plasmid
sequences with 65 % (62/96) (Figure
5). The homologies evidenced by the
spacer sequences studied indicated
a high diversity in terms of the
recognition targets of the CRISPR
en V. vulnicus YJ016. Aunque de
acuerdo con el modelo de clasicación
actual (Makarova et al., 2015), aún
debería ser un sistema CRISPR/
Cas tipo III-D porque los genes cas
encontrados están dentro del arreglo
de subtipos III-D, sin embargo, un
par de genes cas2 se detectó, así
como el gen cas1 en la ubicación
cromosómica 1693776-1694069 bp y
1691704 bp, respectivamente. Esto
no se corresponde con los genes del
subtipo III-D, sino que nos recuerdan
la disposición de las arquitecturas del
subtipo III-A, que poseen los genes
cas10 y csm3 del subtipo III-D, y un
núcleo cas representado por el cas1
y cas2 (Makarova et al., 2015), por lo
que se encuentra en presencia de dos
subtipos muy relacionados, y con un
posible origen común.
El origen de los espaciadores
CRISPR
De las 130/142 (92%) secuencias
espaciadoras únicas encontradas en los
loci CRISPR detectados, es importante
señalar que todas tenían homología
con alguna secuencia contenida en
la base de datos GenBank, así como
una gran diversidad en relación con la
homología presentada con secuencias
relacionadas o no con la familia de
proteobacterias Vibrionaceae. El
53% de los espaciadores (75/142)
presentaron homología con material
genético extracromosómico, mientras
que el 47% restante de las secuencias
espaciadoras (67/142) exhibieron
homología con bacteriófagos (Figura
5). Resultados que indican una
clara función de inmunidad frente a
material genético extraño (plásmidos
o fagos) y una alta especicidad de
377
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
immunity systems examined,
represented by the homology to
DNA sequences related or not to
representatives of the Vibrionaceae
family. Specically, there is little
immunity to typical Vibrio infective
bacteriophages (Figure 5) such as
phage VP2, phage Douglas 12A4 and
phage VSK (the latter is also a host of
P. damselae KC-Na-1) and to plasmid
sequences also present in strains of
the genus Vibrio (Figure 5) such
as p380 of V. coralliilyticus RE98,
plasmid QT6D1 of V. shilonii strain,
plasmid pMJ100 of V. scheri MJ11
and plasmid pYJ016 of V. vulnicus
YJ016 (spacers found at some of the
CRISPR loci type I-F observed), or
against phage of Vibrio 11895-B1
and plasmid p48/10 of V. vulnicus
48/10 (in the CRISPR system type I-E
detected), or against phage of Vibrio
eugene 12A10 and plasmid pSNUTY1
of V. coralliilyticus strain SNUTY-1
(in the CRISPR system type III-D
studied). Like the immunity found
in higher proportion against a great
variety of infective phages of Bacillus,
Enterobacteria, Pseudomonas and
Cyanobacteria (results not shown).
The results obtained show a low
occurrence of CRISPR structures
in these Vibrionaceae species, that
provide them with immunity to lytic
specic phages, especially of the
Vibrio genus, which is important,
considering that this sensitivity can
be explored for the development of
analytical tools such as phage therapy
in shrimp culture, a technology based
on the use of enzymes or phages
for the control of typical shrimp
pathogens.
los diferentes sistemas CRISPR/Cas
estudiados. El tipo de CRISPR que
reunió el mayor número de secuencias
espaciadoras fue el tipo I-F presente
en las especies P. damselae KC-Na-1,
V. parahaemolyticus FORC_022 y V.
vulnicus 93U204, quienes exhibieron
10/96 (10,4%), 28/96 (29,2%) y 58/96
(60,4%) secuencias espaciadoras
respectivamente. En los tipos I-E y
III-D encontrados en las especies V.
harveyi ATCC 43516 y V. vulnicus
YJ016 respectivamente, se observaron
37 y 9 secuencias espaciadoras
correspondientes (Figura 5).
Es importante señalar que las
secuencias espaciadoras encontradas
en el CRISPR tipo I-E fueron las que
presentaron una mayor homología con
las secuencias de bacteriófagos con
76% (28/37) seguidas del tipo III-D con
56% (5/9) y en menor proporción, el tipo
I-F con 35% (34/96). Curiosamente,
por el contrario, los espaciadores
encontrados en el tipo I-F exhibieron
la mayor homología con las secuencias
de plásmido con 65% (62/96) (Figura
5). Las homologías evidenciadas
por las secuencias espaciadoras
estudiadas indicaron una alta
diversidad en términos de las dianas
de reconocimiento de los sistemas
de inmunidad CRISPR examinados,
representada por la homología con
secuencias de DNA relacionadas o
no con representantes de la familia
Vibrionaceae. Especícamente, hay
poca inmunidad a los bacteriófagos
infecciosos típicos de Vibrio (Figura 5)
como el fago VP2, el fago Douglas 12A4
y el fago VSK (este último también es
un hospedador de P. damselae KC-
Na-1) y a las secuencias de plásmidos
378
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
The 92 % of the unique spacer
sequences found in the CRISPR
loci presented homology with some
sequence contained in the GenBank
database against extrachromosomal
genetic material (plasmids) or
bacteriophages, which is indicative
of a clear immunity function against
foreign genetic material and of a high
specicity of the different CRISPR/Cas
systems studied. It has been described
Figure 5. The origin of CRISPR spacers. General description of the CRISPR locus (A),
Spacers acquired in phage or plasmid resistance (B). The CRISPR locus of V.
parahaemolyticus FORC_022 (Type I-F) and V. vulnicus YJ016 (Type III-D) is in
the upper part. The region of spacers and repeats are in the middle: repeats (black
diamonds), spacers (gray or dotted squares numbered, gray, for sequences with
homology for plasmids and dotted, for homology with phage), leader (L, white box).
(Below) the content of the spacer is detailed (C) and the sequences with homology to
phages or plasmids (D). The global distribution of CRISPR spacers in plasmids and
phages (E) and for the type (F) was determined by sequence identity. All spacers
were compared against the GenBank database to nd a sequence of homology.
Figura 5. El origen de los espaciadores CRISPR. Descripción general del locus CRISPR (A),
Espaciadores adquiridos en fagos o resistencia a plásmidos (B). El locus CRISPR
de V. parahaemolyticus FORC_022 (Tipo I-F) y V. vulnicus YJ016 (Tipo III-D) se
encuentra en la parte superior. La región de espaciadores y repeticiones está en el
medio: repeticiones (rombos negros), espaciadores (cuadrados grises o punteados
numerados, gris, para secuencias con homología para plásmidos y punteados, para
homología con fagos), líder (L, recuadro blanco). (A continuación) se detalla el
contenido del espaciador (C) y las secuencias con homología a fagos o plásmidos (D).
La distribución global de espaciadores CRISPR en plásmidos y fagos (E) y para el tipo
(F) se determinó por identidad de secuencia. Todos los espaciadores se compararon
con la base de datos GenBank para encontrar una secuencia de homología.
también presentes en cepas del género
Vibrio (Figura 5) tales como p380
de V. coralliilyticus RE98, plásmido
QT6D1 de la cepa de V. shilonii,
plásmido pMJ100 de V. scheri MJ11
y plásmido pYJ016 de V. vulnicus
YJ016 (espaciadores encontrados en
algunos de los loci CRISPR tipo I-F
observado), o contra el fago de Vibrio
11895-B1 y el plásmido p48/10 de
V. vulnicus 48/10 (en el sistema
379
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
that the CRISPR/Cas system
provides immunity against the virus
in prokaryotes, thanks to the fact
that the spacers are obtained from
invading elements and in this way the
cell can mediate the immune reaction
in a specic way by recognizing the
homologous sequence of such a spacer
(Barrangou and Horvath, 2017).
Therefore, the prole of spacers can be
a reection of the bacterial lifestyle or
of their habitat (Horvath et al., 2009).
In this study, it is important to note
that most of the spacer sequences
studied confer immunity to plasmids
(53 %). Likewise, spacer sequences
were found against a wide variety
of infective phages from Bacillus,
Enterobacteria, Pseudomonas and
Cyanobacteria.
Conclusion
The results obtained in this
research are very promising because
they show a low occurrence of
CRISPR structures in these species
Vibrionaceae with immunity to lytic-
specic phages of the genus Vibrio,
which is importan if we consider that
this sensitivity can be explored for
the development of strategies such
as phagotherapy in shrimp farming,
a technology based on the use of
enzymes or phages for the control of
typical shrimp pathogens, reducing
in this way the losses caused by
infections of shrimp farms.
CRISPR el tipo I-E detectado), o
contra el fago de V. eugene 12A10 y el
plásmido pSNUTY1 de la cepa de V.
coralliilyticus SNUTY-1 (en el sistema
CRISPR tipo III-D estudiado). Como
la inmunidad encontrada en mayor
proporción contra una gran variedad
de fagos infecciosos de Bacillus,
Enterobacteria, Pseudomonas
y Cyanobacteria (resultados no
mostrados). Los resultados obtenidos
muestran una baja ocurrencia
de estructuras CRISPR en estas
especies de Vibrionaceae, que las
dotan de inmunidad frente a fagos
líticos especícos, especialmente del
género Vibrio, lo cual es importante,
considerando que esta sensibilidad
puede ser explorada para el desarrollo
de herramientas analíticas como
terapia de fagos en cultivo de camarón,
una tecnología basada en el uso de
enzimas o fagos para el control de
patógenos típicos del camarón.
El 92% de las secuencias
es
paciadoras únicas encontradas en los
loci CRISPR presentaron homología
con alguna secuencia contenida en la
base de datos GenBank contra material
genético extracromosómico (plásmidos)
o bacteriófagos, lo que es indicativo
de una clara función de inmunidad
contra material genético extraño y de
una alta especicidad de los diferentes
sistemas CRISPR/Cas estudiados. Se
ha descrito que el sistema CRISPR/
Cas proporciona inmunidad frente
al virus en procariotas, gracias a
que los espaciadores se obtienen a
partir de elementos invasores y de
esta forma la célula puede mediar la
reacción inmune de forma especíca
al reconocer la secuencia homóloga. de
End of English Version
380
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
tal espaciador (Barrangou y Horvath,
2017). Por lo tanto, el perl de los
espaciadores puede ser un reejo
del estilo de vida bacteriano o de su
hábitat (Horvath et al., 2009). En este
estudio, es importante señalar que la
mayoría de las secuencias espaciadoras
estudiadas coneren inmunidad a
los plásmidos (53%). Asimismo, se
encontraron secuencias espaciadoras
contra una amplia variedad de fagos
infecciosos de Bacillus, Enterobacteria,
Pseudomonas y Cyanobacteria.
Conclusión
Los resultados obtenidos en esta
investigación son muy prometedores
porque muestran una baja ocurrencia
de estructuras CRISPR en estas
especies Vibrionaceae con inmunidad
a fagos líticos especícos del género
Vibrio, lo cual es importante si
consideramos que esta sensibilidad
puede ser explorada para el desarrollo
de estrategias como la fagoterapia en
el cultivo de camarón, una tecnología
basada en el uso de enzimas o fagos
para el control de patógenos típicos
del camarón, reduciendo de esta
manera las pérdidas ocasionadas por
infecciones de las granjas camaroneras.
Cited literature
Abby, S., B. Néron., H. Ménager., M. Touchon
and E. Rocha. 2014. MacSyFinder:
a program to mine genomes for
molecular systems with an application
to CRISPR-Cas systems. PloS one.
9(10): e110726.
Abouelhoda, M., S. Kurtz and E. Ohlebusch.
2004. Replacing sufx trees with
enhanced sufx arrays. J. Discrete
Algorithms. 2(1): 53-86.
Aguirre, G., J. Sánchez, R. Pérez, A. Palacios,
T. Trujillo and N. de la Cruz. 2010.
Pathogenicity and infection route of
Vibrio parahaemolyticus in american
white shrimp, Litopenaeus vannamei.
J. World Aquac. Soc. 41(3): 464-470.
Alagappan, K., D. Deivasigamani, S.
Somasundaram and S. Kumaran.
2010. Occurrence of Vibrio
parahaemolyticus and its specic
phages from shrimp ponds in east
coast of India. Curr. Microbiol. 61(4):
235-240.
Barrangou, R. and P. Horvath. 2017. A decade
of discovery: CRISPR functions and
applications. Nat. Microbiol. 2(7):
17092.
Benson, D., I. Karsch, D. Lipman., J. Ostell
and D. Wheeler. 2008. GenBank.
Nucleic Acids Res. 36(Database
issue): D25.
Bernal, A., U. Ear and N. Kyrpides. 2001.
Genomes OnLine Database (GOLD):
a monitor of genome projects world-
wide. Nucleic Acids Res. 29(1): 126-
127.
Box, A., M. McGufe., B. O’Hara and K.
Seed. 2016. Functional analysis of
bacteriophage immunity through
a type I-E CRISPR/Cas system in
Vibrio cholerae and its application in
bacteriophage genome engineering. J.
Bacteriol. 198(3): 578-590.
Chakraborty, S., T. Waise., F. Hassan., Y.
Kabir., M. Smith and M. Arif. 2009.
Assessment of the Evolutionary
Origin and Possibility of CRISPR-
Cas (CASS) Interference Pathway
in Vibrio cholerae O395. In silico
biology. 9(4): 245-254.
Cheng, L., J. Huang, C. Shi, K. Thompson,
B. Mackey and J. Cai. 2008. Vibrio
parahaemolyticus associated with
mass mortality of postlarval abalone,
Haliotis diversicolor supertexta (L.),
in Sanya, China. J. World Aquac. Soc.
39(6): 746-757.
Grissa, I., G. Vergnaud and C. Pourcel. 2007a.
CRISPRFinder: a web tool to identify
clustered regularly interspaced short
palindromic repeats. Nucleic Acids
Res. 35 (suppl 2): W52-W57.
381
Esta publicación cientíca en formato digital es continuación de la Revista Impresa: Depósito legal pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2021, 38: 360-381. Abril-Junio.
Parra et al. ISSN 2477-9407
Grissa, I., G. Vergnaud and C. Pourcel. 2007b.
The CRISPRdb database and tools
to display CRISPRs and to generate
dictionaries of spacers and repeats.
BMC Bioinformatics. 8(1):172.
Horvath, P., A. Coûté., D. Romero, P. Boyaval.,
C. Fremaux and R. Barrangou. 2009.
Comparative analysis of CRISPR loci
in lactic acid bacteria genomes. Int. J.
Food. Microbiol. 131(1): 62-70.
Horvath, P. and R. Barrangou. 2010. CRISPR/
Cas, the immune system of bacteria and
archaea. Science. 327(5962): 167-170.
Hyatt, D., G. Chen., P. LoCascio., M. Land., F.
Larimer and L. Hauser. 2010. Prodigal:
prokaryotic gene recognition and
translation initiation site identication.
BMC bioinformatics. 11(1): 119.
Kalatzis, P., D. Castillo, P. Katharios and
M. Middelboe. 2018. Bacteriophage
interactions with marine pathogenic
Vibrios: Implications for phage therapy.
Antibiot. 7(1): 15.
Kurtz, S and C. Schleiermacher. 1999. REPuter:
fast computation of maximal repeats
in complete genomes. Bioinformatics
(Oxford, England), 15(5): 426-427.
Labbate, M., F. Orata., N. Petty., N.
Jayatilleke., W. King., P. Kirchberger
and Y. Boucher. 2016. A genomic island
in Vibrio cholerae with VPI-1 site-
specic recombination characteristics
contains CRISPR-Cas and type VI
secretion modules. Sci. Rep. 6: 36891.
Larkin, M., G. Blackshields., N. Brown.,
R. Chenna., P. McGettigan., H.
McWilliam and J.Thompson, J. D. 2007.
Clustal W and Clustal X version 2.0.
Bioinformatics. 23(21): 2947-2948.
Lomelí, C. and S. Martínez. 2014. Phage therapy
against Vibrio parahaemolyticus
infection in the whiteleg shrimp
(Litopenaeus vannamei) larvae.
Aquaculture. 434: 208-211.
Lyons, C., N. Raustad., M. Bustos and M.
Shiaris. 2015. Incidence of Type II
CRISPR1-Cas Systems in Enterococcus
Is Species-Dependent. PloS one. 10(11):
e0143544.
Makarova, K., Y. Wolf., O. Alkhnbashi., F.
Costa., S. Shah., S. Saunders and P.
Horvath. 2015. An updated evolutionary
classication of CRISPR–Cas systems.
Nat. Rev. Microbiol. 13(11): 722.
Oliveira, J., F. Castilho., A. Cunha and M.
Pereira. 2012. Bacteriophage therapy
as a bacterial control strategy in
aquaculture. Aquacult. Int. 20(5): 879-
910.
Rice, L. and Stokes, L. 2008. Federal Funding
for the study of antimicrobial resistance
in nosocomial pathogens: No ESKAPE.
National Institute of Allergy and
Infectious Diseases. 197(8): 1079-1081.
São, C. 2018. Engineering of phage-derived lytic
enzymes: Improving their potential as
antimicrobials. Antibiot. 7(2): 29.
Shen, J., L. Lv., X. Wang., Z. Xiu and G. Chen.
2017. Comparative analysis of CRISPR
Cas systems in Klebsiella genomes. J.
Basic Microbiol. 57(4): 325-336.
Sun, H., Y. Li., X. Shi., Y. Lin., Y. Qiu., J.
Zhang and Q. Sun. 2015. Association
of CRISPR/Cas evolution with Vibrio
parahaemolyticus virulence factors
and genotypes. Foodborne Pathog Dis.
12(1): 68-73.
Tamura, K., G. Stecher., D. Peterson, A. Filipski
and S. Kumar. 2013. MEGA6: molecular
evolutionary genetics analysis version
6.0. Mol. Biol. Evol. 30(12): 2725-2729.
Yooseph, S., K. Nealson., D. Rusch., J. McCrow.,
C. Dupont., M. Kim., J. Johnson.,
R. Montgomery., S. Ferriera and K.
Beeson. 2010. Genomic and functional
adaptation in surface ocean planktonic
prokaryotes. Nature. 468(7320): 60-66.
Won, K. and S. Park. 2008. Pathogenicity of
Vibrio harveyi to cultured marine
shes
in Korea. Aquaculture. 285(1-4): 8-13.
