© The Authors, 2024, Published by the Universidad del Zulia*Corresponding author: job.bugarin@uan.edu.mx
Keywords:
Gene expression
Gene association
Lipid metabolism
Lamb
Association of gene expression with blood metabolites and fatty acid prole in lambs
Asociación de la expresión de genes con metabolitos sanguíneos y perl de ácidos grasos en corderos
Associação da expressão gênica com metabólitos sanguíneos e perl de ácidos graxos em cordeiros
Clemente Lemus Flores
1
Job Oswaldo Bugarín Prado
2*
Gilberto Lemus Avalos
2
Javier Germán Rodríguez Carpena
1
Gabriela Rosario Peña Sandoval
2
José Lenin Loya Olguin
1
Rev. Fac. Agron. (LUZ). 2024, 41(1): e244102
ISSN 2477-9407
DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v41.n1.02
Animal production
Associate editor: Professor Juan Vergara-Lopez
University of Zulia, Faculty of Agronomy
Bolivarian Republic of Venezuela
Abstract
Some agricultural byproducts can be used as viable alternatives in animal
feed. Therefore, the eect of the inclusion of avocado meal and sunower oil
on the prole of fatty acids, blood metabolites and the expression of genes
associated with lipid metabolism in lambs was evaluated. Three treatments
were evaluated: 0 % control, 10 % avocado meal and 10 % sunower oil
for 84 days. It was found that including avocado meal in the diet increased
the amount of blood glucose and also globulin, but decreased creatinine and
Glutamic Oxaloacetic Transaminase, compared to the addition of sunower
oil where the content of cholesterol, triglycerides, and VLDL decreased. and
R A/G. There was no dierence for muscle fat percentage. The concentration
of fatty acids C20:0, C20:1 and C23:0 was lower with avocado meal, without
aecting the MUFA and UFA values, the UFA/SFA ratio and the saturation
index. The inclusion of avocado meal caused a change in the expression
of the ACACA, FASN, SCD, FASBP3, PPARG and SREBF1 genes in
the Longisimus thoracis muscle, there was a positive association between
glucose and the FASBP3 gene, also of HDL with the PPARG gene, MUFA,
proteins and indices of desaturation of fatty acids were associated with genes
such as SCD, FASN, SREBF1 and ACACA The inclusion of avocado meal is
an alternative to modify genetic expression, also to reduce very low density
cholesterol values in the blood.
1
Universidad Autónoma
de
Nayarit.
Unidad Académica
de
Medicina
Veterinaria
y
Zootecnia.
Carretera
Compostela-
Chapalilla
Km
3,5.
Código
postal:
63700.
Compostela,
Nayarit.
2
Universidad Autónoma
de
Nayarit.
Unidad Académica
de
Agricultura. Carretera Puerto Vallarta – Compostela. Km 9.
Código postal: 63780. Xalisco, Nayarit, México.
Received: 04-09-2023
Accepted: 22-12-2023
Published: 04-02-2024
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2024, 41(1): e244102. January-March. ISSN 2477-9407.
Resumen
Algunos subproductos agrícolas pueden ser utilizados como
alternativas viables en la alimentación animal. Por lo tanto, se evaluó
el efecto de la inclusión de harina de aguacate y de aceite de girasol
sobre el perl de ácidos grasos, metabolitos sanguíneos y la expresión
de genes asociados al metabolismo lipídico en corderos. Se evaluaron
tres tratamientos: 0 % control, 10 % harina de aguacate y 10 % de
aceite de girasol durante 84 días. Se encontró que al incluir harina de
aguacate en la alimentación aumentó la cantidad de glucosa en sangre
y también la globulina, pero disminuyó creatinina y Transaminasa
Glutámica Oxalacética, en comparación con la adición de aceite de
girasol donde disminuyó el contenido de colesterol, triglicéridos,
VLDL y R A/G. No hubo diferencia para el porcentaje de grasa
muscular. La concentración de los ácidos grasos C20:0, C20:1 y C23:0
fue menor con harina de aguacate, sin afectar los valores de MUFA
y UFA, la relación UFA/SFA y el índice de saturación, la inclusión
harina de aguacate causó un cambio en la expresión de los genes
ACACA, FASN, SCD, FASBP3, PPARG y SREBF1 en el músculo
Longisimus thoracis, existió una asociación positiva entre glucosa y el
gen FASBP3, también de HDL con el gen PPARG, MUFA, proteínas
e índices de desaturación de ácidos grasos se asociaron a genes como
SCD, FASN, SREBF1 y ACACA La inclusión harina de aguacate
es una alternativa para modicar la expresión genética, también para
disminuir los valores del colesterol de muy baja densidad en sangre.
Palabras clave: expresión génica, asociación de genes, metabolismo
lipídico, cordero.
Resumo
Alguns subprodutos agrícolas podem ser utilizados como
alternativas viáveis na alimentação animal. Portanto, foi avaliado o
efeito da inclusão de farinha de abacate e óleo de girassol no perl
de ácidos graxos, metabólitos sanguíneos e na expressão de genes
associados ao metabolismo lipídico em cordeiros. Foram avaliados
três tratamentos: 0 % controle, 10 % farinha de abacate e 10 % óleo de
girassol por 84 dias. Vericou-se que a inclusão da farinha de abacate
na dieta aumentou a quantidade de glicemia e também de globulina,
mas diminuiu a creatinina e a Transaminase Glutâmica Oxaloacética,
em comparação à adição de óleo de girassol onde diminuiu o teor
de colesterol, triglicerídeos e VLDL. G. Não houve diferença para
o percentual de gordura muscular. A concentração dos ácidos graxos
C20:0, C20:1 e C23:0 foi menor com a farinha de abacate, sem
afetar os valores de MUFA e UFA, a relação AGL/SFA e o índice
de saturação. A inclusão da farinha de abacate causou alteração no
expressão dos genes ACACA, FASN, SCD, FASBP3, PPARG e
SREBF1 no músculo Longisimus thoracis, houve associação positiva
entre glicose e o gene FASBP3, também de HDL com o gene PPARG,
MUFA, proteínas e índices de dessaturação de gordura ácidos foram
associados a genes como SCD, FASN, SREBF1 e ACACA. A inclusão
da farinha de abacate é uma alternativa para modicar a expressão
genética, também para reduzir os valores de colesterol de densidade
muito baixa no sangue.
Palavras-chave: expressão gênica, associação gênica, metabolismo
lipídico, cabrito.
Introduction
Currently, there are agricultural by-products that can be used in
animal fattening, for example the avocado fruit (Persea americana
Mill.), a product whose high production and export standards have
an impact on the discarding of many fruits due to their small size or
physical damage; however, since the nutritional value of discarded
avocados is not aected, they can be included in rations for sheep
(Bugarín et al., 2021; Lemus-Flores et al., 2020), as it presents high
levels of unsaturated fatty acids, vitamins, antioxidants and minerals,
a high fat content with values ranging from 10 to 30 % (Araujo et al.,
2018), avocado fruits are highly digestible (Ly et al. 2021) contain
mainly fatty acids such as oleic and linoleic, which decrease saturated
fats and the harmful eects of animal fats (Hernández-López et al.,
2016).
Other alternatives in supplementation for domestic animals are
oilseed oils, which are used in ruminant feed (Mapiye et al., 2013;
Zsédely et al., 2012). Several studies indicate that sunower oil
(SO) in ruminants and avocado meal (AM) in pigs are modulators of
intramuscular fat and blood metabolites, so they can be used as viable
alternatives in animal feed (González-Jiménez et al., 2021; Lemus-
Avalos et al., 2020; Wang et al., 2019).
However, it is necessary to know the eect that these nutritional
sources have on lipid metabolism, so this study was proposed with
the objective of evaluating the eect of avocado meal and sunower
oil on the expression of lipid metabolism genes, and to associate it
with the metabolites in blood and lipids in the Longissimus thoracis
muscle in lambs at the nishing stage.
Materials and Methods
Ethics Committee
This project was registered at the Universidad Autónoma de
Nayarit under number SIP15-65, sheep were handled according to the
Mexican Ocial Standards for the use, care (NOM-062-ZOO-1999)
and humane slaughter of domestic and wild animals (NOM-033-
SAG/ZOO-2014).
Location
The trial was conducted at the Academic Unit of Agriculture of
the Universidad Autónoma de Nayarit, 9 km Tepic-Puerto Vallarta
highway, Mexico.
Elaboration of avocado whole fruit paste meal
To prepare the feed rations, Hass avocados were used, from
packing houses in the municipality of Xalisco, Nayarit, Mexico,
following the recommendations of Hernández-López et al. (2016).
The avocado meal and the ration were prepared according to the
recommendations of Lemus-Flores et al. (2020), the vegetable oil
used was sunower oil of the commercial brand “Cristal
®
”, of which
the total amount to be used for the trial was purchased.
Diets and animals
Eight Pelibuey-Dorper male sheep of 24.3 ± 2.7 kg initial BW
were randomly assigned to each of the three experimental diets: 0 %
control, 10 % avocado meal and 10 % sunower oil, for a period of
84 days. To determine the inclusion values, we considered what was
reported by Bugarín et al. (2021) and Lemus-Flores et al. (2020),
who previously worked with the inclusion of avocado paste in sheep
feed; table 1 shows the proximal content of the rations, which had
a forage:concentrate ratio of 40:60, the ingredients used were grain
sorghum, soybean paste, canola paste, molasses, urea and minerals;
2-7
|
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Lemus et al. Rev. Fac. Agron. (LUZ). 2024 40(1): e244102
3-7 |
for daily consumption, 3.5 % of their BW was considered. Prior to the
trial, an adaptation period was considered for the management and
feeding of the sheep.
Table 1. Proximal chemical composition (dry matter basis) of the
experimental rations.
Variable AM SO CO
Total Energy (Mcal) 2.97 3.16 2.58
Crude Protein (CP, %) 14.00 14.00 14.00
Ether Extract (E.E., %) 6.92 12.11 2.39
Crude Fiber (CF, %) 12.43 13.20 13.29
Calcium (Ca, %) 0.75 0.87 0.85
Phosphorus (P, %) 0.30 0.27 0.28
AM: Avocado meal. SO: Sunower oil. CO: Control.
Metabolites in blood
When the sheep were slaughtered, a blood sample was taken
from each one to obtain the blood serum for biochemical analysis,
determined with Byosistem A160 spectrophotometry equipment. The
following were determined: Glucose in mg.dL
-1
, Urea in mg.dL
-1
,
Creatinine in mg.dL
-1
, Uric Acid in mg.dL
-1
. For the lipid prole:
total cholesterol in mg.dL
-1
, triglycerides in mg.dL
-1
, high density
cholesterol (HDL) in mg.dL
-1
, low density cholesterol (LDL) in
mg.dL
-1
, very low density cholesterol (VLDL) in mg.dL
-1
were
quantied. The liver prole was also evaluated: total protein in g.dL
-1
,
Albumin in g.dL
-1
, Globulin in g.dL
-1
and Albumin/Globulin Ratio (R
A/G), also Glutamic Oxaloacetic Transaminase (GOT) in mg.dL
-1
and
Glutamic Pyruvic Transaminase (GPT) in mg.dL
-1
.
Prole of fatty acids in muscle
Intramuscular fat expressed in percentage was quantied in the
samples from L. thoracis muscle, using solvents such as Chloroform-
methanol, according to the method proposed by Folch et al. (1957).
Fatty acid proles were determined in a 30 mg cold methylated
sample in a Bruker Scion 456-GC gas chromatograph with CombiPAL
autosampler, equipped with a programmed temperature vaporization
(PTV) injector, a ame ionization detector (FID) and a Select FAME
capillary column, Agilent J&W CP7420 (100 m x 0.250 mm i.d.
x 0.25 µm). The individual identication of the fatty acids was in
comparison with the Supelco 37 FAME Mix standard (CRM47885),
Pentadecane was used as internal standard. The data obtained were
expressed as the percentage of the total fatty acids contained.
Analysis of gene expression in the L. thoracis muscle
At the time of slaughter of the sheep, 0.5 g samples were taken
from the interior of the L. thoracis muscle at the level of the tenth rib,
using cryotubes with a capacity of 2.0 mL, which had a stabilizing
solution for nucleic acids (DNA/RNA Shield, Zymo Research, USA)
and were stored at -20 ºC.
With 75 mg of tissue in the Direct-zol TM RNA MiniPrep
nucleic acid extraction kit (Zymo Research, USA), RNA extraction
was performed and the concentration and purity were quantied by
Thermo Scientic NanoDrop 2000c spectrophotometry. For cDNA
synthesis, 1000 ng of RNA from each sample was used with the
Maxima H Minus First Strand cDNA Synthesis Kit with dsDNase
(Thermo Scientic, USA). Quantitative real-time polymerase chain
reaction (qPCR) was performed with the Rotor-Gene Q 5plex HRM
Qiagen, with nal volume of 20 uL per reaction containing: cDNA
6 μL (30 ng.μL
-1
of cDNA), 3 μL nucleic acid-free water, 10 μL of
SYBR Green/ROX qPCR Master Mix (2x) (Fermentas, USA) and 1
μL of sense and antisense oligonucleotide for each target gene. The
specic sequence was used for the genes described in table 2. For
real-time amplication was performed for 40 cycles was considered:
initial denaturation (95 °C for 5 minutes), cycling (95 °C for 15
seconds and nally 62 °C for 30 seconds). To conrm the specicity
of the amplication in each array, the denaturation curve analysis
(melting) was used, the temperature ramp of this process was from 62
to 95 °C for 5 seconds.
Table 2. Sequence of the primers used for gene expression analysis.
Genes Forward and Reverse Primers (5’ → 3´) Tm°C Access no.
1ACACA
F- CATGGAAATGTACGCGGACC
R- GGTGGTAGATGGGAAGGAGG
58 NM_001009256
1FASN
F- ACAGCCTCTTCCTGTTTGACG
R- CTCTGCACGATCAGCTCGAC
60 DQ223929
1FAPB3
F- CCTCTCCTTCCACTGACTGC
R- TTGACCTCAGAGCACCCTTT
58 BT021486
2PPARG
F- CATTTCTGCTCCGCACTAC
R- GGAACCCTGACGCTTT
60 NM_001100921.1
2SCD
F- TTCTCTTTCTCCTCATTGCCCC
R-TCGGCTTTGGAAGCTGGAA
60 NM_001100921.1
1SREBP1
F- CCAGCTGACAGCTCCATTGA
R- TGCGCGCCACAAGGA
60 TC263657
RNA S18
F-GGCCTCACTAAACCATCCAA
R-TAGAGGGACAAGTGGCGTTC
56-64 XM_012100710
ACACA: Acetyl-CoA carboxylase α. FASN: Fatty acid synthase. FAPB3: Fatty
acid transport protein. PPARG: Peroxisome proliferator-activated receptor gamma.
SCD: Stearoyl-CoA desaturase. SREBP1: Sterol Regulatory Element Binding
Protein-1. RNA S18: endogenous gene.
Statistical analysis
With the variables of blood metabolites and fatty acid prole
in L. thoracis, an analysis of variance was performed with a linear
mixed model, where the xed eect corresponds to the diet and each
animal was included as a random eect. The comparison of means
for the eect of diets was performed with Duncan’s test (p<0.05)
in the Statistical Product and Service Solutions Software (SPSS,
2011). For statistical analyses of gene expression in L. thoracis the
method of Steibel et al. (2009) was used, Ct values for target and
endogenous genes were considered with the use of a linear mixed
model. For this, a univariate analysis model was used for each
gene in the recorded gene expression readings. To evaluate dietary
dierences in expression rate in genes of interest (diT) normalized
by endogenous gene, AM vs CO, SO vs CO, and AM vs SO contrasts
were performed. Adjusted probability (P) values were calculated by
using the Bonferroni correction method. To obtain the fold change
(FC) values from the estimated diT values between the contrasts, the
equation: FC =2
-diT
was used. The calculations were performed with
the Statistical Product and Service Solutions Software (SPSS, 2011).
Concentration values were calculated for each sample for each
diet and gene, following the software equation on the Rotor-Gene Q
5plex HRM Qiagen computer (concentration=10^
((Ct-B0)/B1)
; where 10^
is the 10 power to normalize the log10 Ct, B0 the intercept value of
the regression equation and B1 the slope value.
The association between values of concentrations calculated as
log10 normalized quantitative expression with the variables blood
metabolites and fatty acid prole was evaluated with Minitab 15
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Rev. Fac. Agron. (LUZ). 2024, 41(1): e244102. January-March. ISSN 2477-9407.
Statistical Software (Minitab, 2007), in a principal component
analysis, using the correlations with signicant probability and the
relationships between the variables and the diets were plotted.
Results and discussion
When comparing rations with AM and SO in relation to blood
metabolites (table 3), it was observed that AM (P<0.05) increased
in almost 15 mg.dL
-1
the amount of glucose in blood compared to
the control diet and the amount of globulin of the AM diet (4.12)
increased 0.67 g.dL
-1
compared to the SO (3.45), in addition,
creatinine (1.09) and TGO (63.86) decreased compared to the SO diet
(1.45 and 91.57, respectively); the inclusion of AM compared to SO
decreased cholesterol, triglycerides, VLDL and R A/G, which could
be a tendency in the modication of these variables by the inclusion
of AM (P<0.10). The increase in blood glucose due to the inclusion
of AM reects a greater disposition of energy, associated to a greater
production of propionic acid available for muscle production, as
reported by de Castro et al. (2023) and Rodrigues et al. (2022).
Globulin is associated with greater immunological response,
creatinine with less renal eects and TGO with less hepatic damage,
so a positive eect is observed with AM on animal health, a situation
similar to that reported by Avellanet et al. (2007). The inclusion of
SO presented an increase of cholesterol (72.00) in blood with respect
to the control diet (61.83), this is associated with the increase of
triglycerides and VLDL, as a result of a greater absorption of lipids
in the intestine, due to the existence of a greater availability of lipids
in the diet containing SO. The eect of cholesterol lowering with
AM coincides with de Castro et al. (2023) when using Theobroma
grandiorum in sheep, similar when using pomegranate peel extract
in cows (Abarghuei et al., 2014) and moringa foliage used as feed in
sheep (Astuti et al., 2011).
According to Rodrigues et al. (2022) the higher R A/G in the
diet with SO indicates higher microbial protein available in the
intestine. According to what was obtained with the inclusion of AM,
it is possible that this is more metabolized in the rumen and does
not exceed a greater amount of lipids and proteins compared to the
inclusion of SO, as happened to Abarghuei et al. (2014) when they
used pomegranate extract in the feeding of cows. Total protein and
albumin were similar between diets because they were isoproteic and
the protein content of avocado paste is low (5 %). Substituting starches
for fats as energy sources can aect ruminal fermentation depending
on the level of unsaturation in fatty acids or that of the fats used,
which should be 2 and 6 % inclusion (Santana and Correa, 2016). A
higher than recommended level of sunower oil could inuence TGO
concentrations, R A/G, globulin, creatinine and glucose. There were
no statistical dierences in the rest of the variables.
The fat content and fatty acid prole of L. thoracis muscle are
presented in table 4. The percentage of fat was statistically similar
between treatments (P>0.05). The C20:0 and C20:1 fatty acid
contents were lower with the inclusion of AM than with the inclusion
of SO, with no statistical dierences (P>0.05), when CO treatment
was compared with SO treatment and CO treatment with AM
treatment. The C23:0 content was the same (0.25 %) for the SO and
CO treatments, which were higher than that of the AM treatment with
0.14 %. The values of saturated (SFA) and polyunsaturated (PUFA)
fatty acids were statistically equal with the inclusion of AM, while the
monounsaturated (MUFA), unsaturated (UFA), unsaturated/saturated
(UFA/SFA) and desaturation index showed a slight increase with
the inclusion of AM, which was not sucient to present signicant
statistical dierences. Miltko et al. (2019) achieved a decrease in SFA
when axseed oil was included in sheep feed and pointed out that this
result may be a reection of incomplete biohydrogenation due to the
high consumption of unprotected fats rich in linolenic acid.
On the other hand, the MUFA content of 51.9 % in avocado
paste was reected in the UFA content and UFA/SFA ratio in L.
thoracis muscle. High SFA content in food for human consumption
is undesirable because it inuences the increase of LDL (Kostik et
al., 2013). The fatty acid prole in L. thoracis with AM is within that
reported for some breeds of sheep from dierent countries (Díaz et
al., 2005). Romero-Bernal et al. (2017) indicate that the inclusion of
sh meal in sheep increases intramuscular fat in L. thoracis muscle,
contrary to the inclusion of soybean meal where no statistically
signicant decrease in the percentage of fat was observed. A similar
situation occurred for PUFA values and in the AM treatment there was
an increase in MUFA content but this was not statistically signicant.
This slight increase in the modication of fatty acids in L. dorsi
when AM was included in the animal feed is important and could
perhaps improve with a higher consumption of AM, as happened in
pigs (Hernández-López et al., 2016), also in sheep without aecting
productive behavior (Bugarín-Prado et al., 2021; Lemus-Flores et
al., 2020), due to the digestibility of its lipids and the availability of
MUFA (Ly et al., 2021). However, high levels of AM can improve
Table 3. Blood metabolite concentrations observed with the experimental diets.
Metabolites AM CO SO eem P Value
Glucose, mg.dL
-1
126.14
a
111.29
b
114.57
ab
2.66 0.05
Creatinine, mg.dL
-1
1.09
b
1.31
ab
1.45
a
0.06 0.04
Total cholesterol, mg.dL
-1
66.75
ab
61.83
b
72.00
a
2.04 0.09
Triglycerides, mg.dL
-1
50.13
b
64.50
a
56.75
ab
2.95 0.09
VLDL. Very Low Density Cholesterol, mg.dL
-1
10.03
b
12.90
a
11.35
ab
0.59 0.09
Total protein, g.dL
-1
6.75 6.38 6.25 0.13 0.30
Albumin, g.dL
-1
2.37 2.39 2.67 0.08 0.25
Globulin, g.dL
-1
4.12
a
4.13
a
3.45
b
0.13 0.03
R A/G. Albumin/Globulin ratio 0.56
b
0.55
b
0.72
a
0.03 0.10
TGO. Glutamic oxaloacetic transaminase, mg.dL
-1
63.86
c
76.75
b
91.57
a
3.03 0.01
AM: Avocado meal. CO: Control. SO: sunower oil.
abc
Dierent literals between columns indicate signicant statistical dierence. **P<0.05 *P<0.10. NS: Not signicant.
eem: Standard error of the mean.
4-7
|
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Lemus et al. Rev. Fac. Agron. (LUZ). 2024 40(1): e244102
5-7 |
meat quality, without aecting the amount of fat, but aect ration
consumption, as has been reported in monogastrics and ruminants (de
Evan et al., 2020; Fránquez et al., 2017; Ruíz-Dimas et al., 2022).
Table 4. Fat percentage and lipid prole of Longissimus thoracis
with the experimental diets.
AM CO SO eem Valor P
Fat % 4.05 4.09 3.06 0.82 0.59
C20:0 0.08
b
0.10
ab
0.13
a
0.01 0.01
C20:1 0.11
b
0.13
ab
0.16
a
0.01 0.03
C23:0 0.14
b
0.25
a
0.25
a
0.03 0.03
% SFA 47.16 52.93 51.63 2.98 0.73
% MUFA 46.61 40.31 40.36 3.37 0.71
% PUFA 6.16 6.68 7.62 0.53 0.56
% UFA 52.77 41.99 47.98 3.25 0.42
UFA/SFA 1.13 0.99 1.05 0.09 0.81
Desaturase index 0.52 0.45 0.46 0.06 0.70
AM: Avocado meal. CO: Control. SO: Sunower oil. sEm: Standard error of the
mean.
a, b, c
Dierent letters indicate statistical dierence signicant at P<0.05.
Table 5 shows the dierent changes in gene expression (FC) in L.
thoracis muscle for the diet comparisons. When AM was included,
it was observed that in relation to the CO diet there was an increase
in the expression of the genes analyzed (ACACA, FASN, SCD,
FASBP3, PPARG and SREBF1). When the diet included SO and was
compared with the CO treatment, there were two genes (FASN and
SCD) that did not show signicant dierences. When the inclusion of
AM vs. SO was compared only in the expression of the PPARG gene,
the AM treatment had higher expression in ve genes (ACACA,
FASN, SCD, FASBP3 and SREBF1). Feeding the sheep with AM
presented higher gene expression compared to CO and SO, which
indicates physiological eects on lipid modulation in L. thoracis, in
this sense Lemus-Avalos et al. (2020), mention that gene expression
associated with lipid metabolism is dierent in each animal species
and according to each tissue. The increase in the PUFA ratio in L.
thoracis muscle reduced the expression of FASN, SCD and SREBP1
genes when sunower oil was used, similar to that reported by Mohan
et al. (2012), considering that the diet with GA tended to present a
higher amount of PUFA than the diet with AM, the eect was similar
when decreasing the expression of these genes in GA and comparing
them with AM, a similar situation occurred in an evaluation in lambs
where soybean, cotton and rapeseed meals were added to the diet
with a decrease in PUFA in thoracic muscle and an increase in the
expression of lipogenic genes (Wang et al., 2019).
In gure 1, with principal component analysis 1 (PC1), 13.3 %
variability and 2 (PC2) with 86.7 % variability through the correlation
matrix, it was observed in the right quadrants (PC1) that all the genes
(ACACA, FASN, SCD and FASBP3 are lipogenic and PPARG and
SREBF1 adipogenic) were related to the inclusion of 10 % AM.
In this same principal component analysis, when correlating the
log10 normalized quantitative expression with the variables blood
metabolites and fatty acid prole, it was also observed that with the
inclusion of 10 % AM there is an association with the expression of
the genes studied (right quadrant CP1): an association of glucose with
the FASBP3 gene, also HDL with the PPARG gene. Associations of
MUFA, proteins and fatty acid desaturation indices with the SCD,
FASN, SREBF1 and ACACA genes. In the left quadrant of CP1, it
was appreciated that in CO diets and with inclusion of SO at 10 %,
there is association with SFA, PUFA, VLDL and LDL. The amount of
fat in L. thoracis, being in the middle of the quadrants of the principal
components as shown in gure 1, was not associated with gene
expression or with the diets tested.
AM. avocado our. SO. Sunower oil. CO. Control.
Figure 1. Association of genes through principal components
according to the dietary rations used.
In a study conducted by Wang et al. (2019) where they
supplemented the diet for sheep by increasing the amount of protein
and ether extract, an increase in the expression of FAS, SREBF1 and
PPARG genes was observed, similar to what happened here when AM
Table 5. Changes in gene expression (FC) in L. thoracis for diet comparisons.
Contrast
AM vs CO SO vs CO AM vs SO
FC eem P < FC eem P < FC eem P <
ACACA 1.14 0.005 0.0001 1.04 0.005 0.0001 1.10 0.005 0.0001
FASN 1.15 0.004 0.0001 1.00 0.004 1.0000 1.14 0.004 0.0001
FASBP3 1.15 0.004 0.0001 1.06 0.004 0.0001 1.09 0.004 0.0001
PPARG 1.11 0.055 0.05 1.21 0.055 0.001 0.92 0.055 0.10
SCD 1.05 0.009 0.001 0.99 0.009 0.09 1.07 0.009 0.001
SREBF1 1.34 0.01 0.001 1.07 0.01 0.001 1.25 0.01 0.001
AM: avocado meal. CO: Control. SO: avocado oil. FC: gene expression. eem: Standard error of the mean. ACACA: Acetyl-CoA carboxylase α.FASN: Fatty acid synthase.
FAPB3: Fatty acid transporter protein. PPARG: Peroxisome proliferator-activated receptor gamma. SCD: Stearoyl-CoA desaturase. SREBP1: Sterol Regulatory Element
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Lemus et al. Rev. Fac. Agron. (LUZ). 2024 40(1): e244102
6-7 |
was added at 10 %, with an increase in MUFA. In this sense Yue et
al. (2016), mention that the expression of lipogenic genes is involved
for the increase of fatty acid desaturation, which is associated with
the increase of MUFA by SFA. An association such as glucose with
the FASBP3 gene could mean a greater development of muscle tissue
according to Castro et al. (2023) and Rodrigues et al., (2022).
Conclusion
The inclusion of 10 % avocado meal caused changes in the
expression of ACACA, FASN, SCD, FASBP3, PPARG and SREBF1
genes in Longissimus thoracis muscle in lambs, there was a correlation
of ACACA, FASN, SCD and FASBP3 genes which are lipogenic and
PPARG and SREBF1 genes with adipogenic action, FASN, SCD and
FASBP3, which have lipogenic action, and PPARG and SREBF1,
which have adipogenic action, were correlated with the inclusion of
10 % AM, when correlating the variables of blood metabolites and
the fatty acid prole, it was observed that with the inclusion of 10 %
AM there is an association with the expression of the FASBP3 genes
with glucose, the PPARG gene with HDL, the SCD, FASN, SREBF1
and ACACA genes with proteins and fatty acid desaturation indexes,
without this expression being associated with increases in muscle
fat, nally a decrease in the values of very low density cholesterol in
blood was observed.
Acknowledgments
To the Consejo Nacional de Humanidades, Ciencia y Tecnología
(CONAHCyT) for funding the project “Uso de aguacate de desecho
en la manipulación de la calidad y composición de la carne porcina y
ovina para producir alimentos funcionales con estabilidad oxidativa”
grant I0002, PDCPN 2014-I.
Literature cited
Abarghuei, M. J., Rouzbehan, Y., Salem, A. Z. & Zamiri, M. J. (2014). Nitrogen
balance, blood metabolites and milk fatty acid composition of dairy cows
fed pomegranate-peel extract. Livestock. Science. 164, 72–80. https://doi.
org/10.1016/j.livsci.2014.03.021
Araujo, R. G., Rodriguez-Jasso, R. M., Ruiz, H. A., Pintado, M. M. E. &
Aguilar, C. N. (2018). Avocado by-products: nutritional and functional
properties. Trends in Food Science & Technology, 80, 51-60. https://doi.
org/10.1016/j.tifs.2018.07.027
Astuti, D. A., Babab, A. S. & Wibawanc, I. W. T. (2011). Rumen Fermentation,
Blood Metabolites, and Performance of Sheep Fed Tropical Browse
Plants. Media Peternakan, 34(3), 201-206. https://doi.org/10.5398/
medpet.2011.34.3.201
Avellanet, R., Cuenca, R., Pastor, J. y Jordana, J. (2007). Parámetros hematológicos
y bioquímico clínicos en la raza ovina xisqueta. Archivos de Zootecnia,
56(Sup. 1), 497-501. https://www.redalyc.org/pdf/495/49509922.pdf
de Castro Budel, J. C., Gomes de Castro, V. C., Mota de Souza, S., de Souza
Nahúm, B., Correa Barbosa, A. V., Silva Rodrigues, L., Berndt, A.,
Navajas Rennó, L., de Morais, E., Rodrigues da Silva, J. A., de Carvalho
Rodrigues, T. C. G., Maciel e Silva, A. G. & Lourenço-Junior, J. B.
(2023). Methane emission, intake, digestibility, performance and blood
metabolites in sheep supplemented with cupuassu and tucuma cake in the
eastern Amazon. Frontier in Veterinary Science, 10, 1106619. https://doi.
org/10.3389/fvets.2023.1106619
Bugarín-Prado, J. O., Lemus-Flores, C., Grageola-Núñez, F., Valdivia-Bernal,
R. y Bonilla-Cárdenas, J. (2021). Efecto de suplementación con harina
de aguacate en dietas de corderos sobre crecimiento y el rendimiento
de la canal. Abanico Veterinario, 11, 1-12. http://dx.doi.org/10.21929/
abavet2021.32
de Evan, T., Carro, M. D., Fernández, Yepes .J. E., Haro, A., Arbesú, L., Romero-
Huelva, M. & Molina-Alcaide, E. (2020). Efects of Feeding Multinutrient
Blocks Including Avocado Pulp and Peels to Dairy Goats on Feed Intake
and Milk Yield and Composition. Animals, 10(2), 194. https://doi.
org/10.3390/ani10020194
Díaz, M. T., Álvarez, I., De la Fuente, J., Sañudo, C., Campo, M. M., Oliver, M. A.,
Font i Furnols, M., Montossi, F., San Julián, R., Nute, G. R. & Cañeque,
V. (2005). Fatty acid composition of meat from typical lamb production
systems of Spain, United Kingdom, Germany and Uruguay. Meat Science,
71(2), 256–263. https://doi.org/10.1016/j.meatsci.2005.03.020
Folch, J., Lees, M., & Sloane Stanley, G. H. (1957). A simple method for the
isolation and purication of total lipides from animal tissues. The Journal
of biological chemistry, 226(1), 497–509. http://dx.doi.org/10.1016/
S0021-9258(18)64849-5
Fránquez, P., Rodríguez, G., Lemus, C., Grageola, F. & Ly, J. (2017). Performance
traits and índices of the intake pattern of fattened pigs with fresh paste of
whole avocado. Cuban Journal of Agricultural Science, 51(3), 329-336.
http://cjascience.com/index.php/CJAS/article/view/755
González-Jiménez, A. C., Mejía-Martínez, K., Becerra-Verdín, E. M., Bugarín-
Prado, J. O. & Lemus-Flores. C. (2021). Carcass characteristics and
blood biochemical proles in nishing pigs fed with dierent levels of
avocado paste (Persea americana Mill.). Brazilian Journal of Animal
and Environmental Research, 4(2), 2344-2359. https://doi.org/10.34188/
bjaerv4n2-064
Hernández-López, S. H., Rodríguez-Carpena, J. G., Lemus-Flores, C., Grageola-
Nuñez, F. & Estévez, M. (2016). Avocado waste for nishing pigs: Impact
on muscle composition andoxidative stability during chilled storage. Meat
Science, 116, 186-192. https://doi.org/10.1016/j.meatsci.2016.02.018
Kostik, V., Memeti, S. & Bauer, B. (2013). Fatty acid composition of edible oils
and fats. Journal of Hygienic Engineering and Design, 4, 112-116. https://
eprints.ugd.edu.mk/11460/1/06. %20Full %20paper %20- %20Vesna
%20Kostik %202.pdf
Lemus-Avalos, G., Lemus-Flores, C., Bugarín-Prado, J. O., Grageola-Núñez,
F., Ayala-Valdovinos, M. A., Duifhuis-Rivera. T., Moo-Huchin, V. M.
& Dzib-Cauich, D. (2020). Eect of diets with avocado meal on lipids
in muscle, antioxidants and gene expression in nished pigs. Revista
BioCiencias, 7, e968. https://doi.org/10.15741/revbio.07.e968
Lemus-Flores, C., Bugarín-Prado, J. O., Grageola Nuñez, F., Valdivia Bernal, R.,
Ruiz Dimas, I., Bonilla Cardenas, J. A. & Segura Correa, J. C. (2020). The
eect of avocado our, sunower oil and dierent forage: concentrate
ratios in the nal diet on feed intake, digestibility and productive
performance of male sheep. Veterinarski Arhiv, 90(4), 353-364. https://
hrcak.srce.hr/le/356220
Ly, J., Fránquez, P., Rodríguez, G., Lemus, C., Domínguez, I. A. & Grageola, F.
(2021). Note on in vitro digestion of avocado products for pigs. South
African Journal of Animal Science, 51, 138–141. https://hdl.handle.
net/10520/ejc-sajas_v51_n1_a16
Mapiye, C., Aalhus, J. L., Turner, T. D., Rolland, D. C., Basarab, J. A., Baron,
V. S., McAllister, T. A., Block, H. C., Uttaro, B., Lopez-Campos, O.,
Proctor, S. D. & Dugan, M. E. R. (2013). Eects of feeding axseed or
sunower-seed in high-forage diets on beef production, quality and fatty
acid composition. Meat Science, 95, 98-109. https://doi.org/10.1016/j.
meatsci.2013.03.033
Miltko, R., Majewska, M. P., Bełżecki, G., Kula, K. & Kowalik, B. (2019).
Growth performance, carcass and meat quality of lambs supplemented
dierent vegetable oils. Asian-Australas Journal Animal Science. 32(6),
767-775. https://doi.org/10.5713/ajas.18.0482
Minitab 15 Statistical Software (Minitab v15). (2007). [Computer software]. State
College, PA: Minitab, Inc. www.minitab.com
Mohan, N., Harihara, I., Babul, C., Madan, K., Anubrata, D. & Kalita, D.
(2012). Eect of dietary sunower oil and coconut oil on adipose tissue
gene expression, fatty acid composition and serum lipid prole of
grower pigs. Archives of Animal Nutrition, 66(4), 271-282. https://doi.
org/10.1080/1745039X.2012.683324
Rodrigues Cavalcante, I. T., Hauss de Sousa, W., Ribeiro, N. L., Queiroga Cartaxo,
F., de Farias Ramos, J. P. & de Azevedo, P. S. (2022). Animal feed
based on forage cactus: use of viscera in traditional dishes. Production
of by-products that can result in an economic return. Food Science and
Technology, 42, e105921. https://doi.org/10.1590/fst.105921
Romero-Bernal, J., Morales Almaraz, E., Castelán Ortega, O. O., Pescador
Salas, N. & González-Ronquillo, M. (2017). Chemical composition and
fatty acid prole in meat from grazing lamb diets supplemented with
ryegrass hay, shmeal and soya bean meal as PUFA sources. Ciencia
Rural Santa María, 47(4), e20160533. http://dx.doi.org/10.1590/0103-
8478cr20160533
Ruíz-Dimas, I., Lemus-Flores, C., Bonilla-Cárdenas, J. A., Rodríguez-Carpena,
J. G., Valdivia-Bernal, R., Grageola-Núñez, F. & Bugarin-Prado. J. O.
(2022). Acceptability of meal of avocado full fruit included in the diet for
sheep and pigs. Brazilian Journal of Animal and Environmental Research,
Curitiba, 5(1), 193-199. https://doi.org/10.34188/bjaerv5n1-015
Santana, G. y Correa, H. J. (2016). Inclusión de tres fuentes lipídicas en la dieta
This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.
Lemus et al. Rev. Fac. Agron. (LUZ). 2024 40(1): e244102
7-7 |
de vacas lactantes bajo pastoreo sobre el consumo y la digestibilidad.
Livestock Research for Rural Development, 28(3), 38. http://www.lrrd.
org/lrrd28/3/sant28038.html
Statistical Product and Service Solutions (SPSS). (2011). IBM SPSS Statistics for
Windows, Versión 20.0. Armonk, NY: IBM Corp. https://www.ibm.com/
mx-es
Steibel, J. P., Poletto, R., Coussens, P. M. & Rosa, G. J. M. (2009). A powerful
and exible linear mixed model framework for the analysis of relative
quantication RT-PCR data. Genomics, 94(2), 146-152. https://doi.
org/10.1016/j.ygeno.2009.04.008
Wang, X., Yan, S., Shi, B., Zhang, Y. & Guo, X. (2019). Eects of concentrate
supplementation on fatty acid composition and expression of
lipogenic genes of meat and adipose tissues in grazing lambs.
Italian Journal of Animal Science, 18(1), 554-563. https://doi.
org/10.1080/1828051X.2018.1547666
Yue, Y., Cheng, X., Zhao, S. G., Liu, Z., Liu, L. S., Zhou, R., Wu, J. P. & Brown,
M. A. (2016). Eects of tail docking on the expression of genes related to
lipid metabolism in Lanzhou fat-tailed sheep. Genet Molecular Research,
15(1), 1-10. http://dx.doi.org/10.4238/gmr.15017323
Zsédely, E., Király, A., Szabó, C. S., Németh, K., Dóka, O. & Schmidt, J. (2012).
Eect of dietary linseed oil soap on lamb meat. World Academy Science
Engineering and Technology, 6(3), 67-70. https://publications.waset.
org/13519/pdf