https://doi.org/10.52973/rcfcv-e33304
Received: 14/08/2023 Accepted: 20/09/2023 Published: 24/09/2023
1 of 6
Revista Científica, FCV-LUZ / Vol. XXXIII, rcfcv-e33304
RESUMEN
La infección por Brucella canis es una enfermedad zoonótica a
menudo desatendida pero importante. Este estudio pretende
determinar su seroprevalencia en perros Pit Bull de la región
occidental de la península turca de Anatolia. En la provincia de Manisa,
se tomaron muestras de sangre de 2 mL de la región antebraquial,
de 35 perros Pit Bull utilizando tubos de sangre estériles con K
2
EDTA
(3,6 mg), y las muestras se analizaron utilizando, tanto la prueba
de microaglutinación con mercaptoetanol como técnicas de PCR
especícas de B. canis. De los 35 perros analizados mediante 2–ME
RSAT, 13 (37,14%) dieron positivo y 22 (63%) negativo. De los 13 perros
que dieron positivo por 2–ME RSAT, 8 (22,85%) eran hembras y 5
(14,28%) machos. El posterior análisis por PCR de todas las muestras
reveló que 7 (20%; 7/35) de las muestras que dieron positivo a 2–
ME RSAT eran en realidad positivas a la PCR especíca de B. canis.
Estos hallazgos sugieren que B. canis está presente en los perros Pit
Bull, aunque proporcionan una idea general de la prevalencia de la
enfermedad en la región. Se necesitan estudios multicéntricos con un
mayor número de casos en diferentes grupos de Pit Bulls, como sanos,
pacientes y grupos de riesgo, para proporcionar evidencia completa.
Palabras clave: Brucella canis; Pit Bull brucelosis; 2–ME RSAT; PCR
ABSTRACT
Brucella canis infection is an often neglected but important zoonotic
disease. This study aims to determine its seroprevalence in Pit Bull
dogs from the Western Region of the Turkish Anatolian Peninsula.
In the Province of Manisa, 2 mL blood samples were taken from
the antebrachial region of 35 Pit Bull dogs using sterile K
2
EDTA
(3.6mg) blood tubes, and the samples were analyzed using both the
mercaptoethanol (ME) microagglutination test and B. canis–specic
PCR techniques. Of the 35 dogs tested by 2–ME RSAT, 13 (37.14%)
tested positive and 22 (63%) tested negative. Of the 13 dogs that
tested positive for 2–ME RSAT, 8 (22.85%) were female, and 5 (14.28%)
were male. Subsequent PCR analysis of all samples revealed that 7
(20%; 7/35) of the samples that tested positive for 2–ME RSAT were
actually B. canis–specic PCR positive. These ndings suggest that B.
canis is present in Pit Bull dogs, although they provide a general idea
of the disease's prevalence of the disease in the region. Multicentre
studies with larger numbers of cases in different groups of Pit Bulls,
such as healthy, patient and risk groups, are needed to provide
comprehensive evidence.
Key words: Brucella canis; Pit Bull brucellosis; 2–ME RSAT; PCR
Detection of Brucella canis infection in Pit Bull breed dogs in Turkey
Detección de infección por Brucella canis en perros de raza Pit Bull en Turquía
Volkan Özavci
1
* , Haze Tuğba Yüksel–Dolgun
2
, Yiğit Seferoğlu
2
, Şükrü Kirkan
2
1
Dokuz Eylül University, Faculty of Veterinary Medicine, Department of Microbiology. Kiraz, Izmir, Turkey.
2
Aydin Adnan Menderes University, Faculty of Veterinary Medicine, Department of Microbiology. Efeler, Aydin, Turkey.
*Corresponding author: volkan.ozavci@deu.edu.tr
FIGURE 1. The summarized general sequence of the transmission and subsequent
clinical events of Brucella canis infection in dogs
Brucella canis in pit bull breed dogs/ Özavci et al. __________________________________________________________________________________
2 of 6
B. canis enters via genitals, nose, or eyes, taken up by immune cells,
settles in lymph nodes, spleen, and genitals through blood. Bacteremia
lasts 1–4 wk, can extend to 6 months [11]. Canine brucellosis
spreads venereally, orally, via secretions, placenta, and semen.
The pathogen remains unaffected by the procedures conducted
during semen freezing, retaining its vitality [14]. Bacteria can infect
the reticuloendothelial cells such as osteoblasts, osteoclasts, and
broblasts, particularly macrophages [15], and placenta [16]. It is
noteworthy that these microorganisms are classied as hidden
pathogens, as they avoid producing conventional virulence markers
such as Brucella spp. toxins or adhesins within host macrophages [17].
In pregnant dogs with brucellosis, symptoms may appear between
45–55 d of pregnancy. Weak puppies or stillbirths that may die a few
days after birth or abortion can be seen on the day of birth [5]. The
disease also has zoonotic signicance. B. canis has the potential to
cause severe illness in humans [5]. Some cases of human infection
have been linked to non–clinical domestic dogs that have had close
contact with individuals diagnosed with brucellosis. However,
identifying subclinically infected pet dogs, which lack visible clinical
symptoms, can be challenging for both owners and veterinarians [18].
Even when infected domestic dogs exhibit no symptoms, transmission
of B. canis to humans has been observed [19].
This study aimed to investigate the presence of canine brucellosis
in the Western part of Turkey using a 2–mercaptoethanol rapid slide
agglutination test and species–specic PCR method in blood samples
obtained from Pit Bulls housed at a shelter.
MATERIALS AND METHODS
Sample collection
Between March and April 2023, a total of 35 Pit Bull breed dogs
located in the Temporary Animal Care Center of Manisa Metropolitan
Municipality had 2 mL blood samples taken from their vena cephalica
antebrachii using sterile ethylenediaminetetraacetic acid (K
2
EDTA)
(3.6mg) blood tubes (BD, Plymouth, United Kingdom). The blood samples
were transported in ice boxes (Igloo, Playmate, Texas, USA) to the
Microbiology Department of Aydin Adnan Menderes University Faculty
of Veterinary Medicine Research laboratory. The samples were kept
at room temperature for 30 min and centrifuged for 15 min at 2,770 × G
(Hettich, Tuttlingen, Germany). The obtained sera were transferred into
1.5 mL Eppendorf tubes and stored in a -4°C freezer (Bosch, Series 4,
Germany) for serological analysis. Ethical approval for this study was
obtained from the Dokuz Eylul University Animal Experiments Local
Ethics Committee (08/02/2023, and protocol no:08/2023).
Serological tests
The serological test antigen 2–ME (2–mercaptoethanol) rapid slide
agglutination test (RSAT) was prepared as previously described [20].
Each serum sample was mixed with 25 µL of 0.2 M 2–ME solution
(Thermo Fisher Scientic, Massachusetts, USA) for at least 45 s.
Then, 25 µL of B. canis antigen was added, and after 2 min of orbital
shaking, agglutination was observed. Agglutination formation was
considered a positive result [21].
Polymerase chain reaction (PCR), serotyping and DNA extraction
The BcSS primers (Sentebiolab, Ankara, Turkey), specific to
the B. canis species, used in our study were as follows: F: 5'–
CCAGATAGACCTCTCTGGA–3', R: 5'–TGGCCTTTTCTGATCTGTTCTT–3'
INTRODUCTION
Brucellosis is a zoonotic disease caused by a group of Gram–
negative, aerobic (which may require additional CO
2
), coccobacillus,
facultative and intracellular bacteria belonging to the Brucella
genus, which can cause serious Public Health problems as well as
signicant economic losses on a global scale due to its potential
to infect animals. There are twelve species of Brucella genus that
are accepted, and dogs (Canis familiaris) can be infected with four
of the six species of Brucella spp. (including B. canis, B. abortus, B.
melitensis, B. suis, B. ovis, and B. neotomae) [1, 2, 3, 4]. Contact with
contaminated uids from infected dogs is also an important but
rare source of infection in humans. It is estimated that only 1% of
diagnosed human brucellosis cases are due to B. canis infection [5].
The pathogen has the ability to breach the human body's defences
through a variety of entry points, including cracks in the skin, mucous
membranes, and the conjunctiva, as well as inltrating the respiratory,
cardiovascular, and gastrointestinal systems. This invasion often
results in a systemic infection that can manifest in two distinct
phases: acute and chronic. The clinical presentation of this disease
may encompass a range of symptoms, including fever, chills, joint
pain or inammation, enlargement of the liver or spleen, and the
swelling of lymph nodes [6, 7].
Puppies can be infected through intrauterine vertical transmission
or oronasal transmission, which can occur via contaminated milk
after birth, contact with placental membranes, or vaginal discharge
after abortion. Surviving infected puppies may become permanent
carriers of B. canis. However, spayed dogs may still many develop
complications [5, 8]. Dogs can also be infected in many ways (FIG.1)
[9]. Symptoms of infection in dogs are sometimes not obvious.
Males may experience problems like epididymitis, prostatitis, and
orchitis, affecting testicular size, sperm absence, and fertility [10].
Female dogs may abort between 45–59 days (d) of pregnancy, with a
discharge lasting 1–6 weeks (wk). After abortion, around 100 billion
microorganisms per mL can spread from infected uterine discharges
to the environment in 4–6 wk [11, 12]. In addition, endometritis and
placentitis can be seen in female dogs [13].
FIGURE 2. B. canis specic PCR results of Pit Bull dogs. M: 100 bp ladder (Hibrigen),
N: Negative control; P: B. canis RM666 ATCC 23365 positive control; 3,5,7,16,18,20,28:
B. canis positive samples; 31: B. canis negative samples
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33304
3 of 6
B. canis infection in humans is usually acquired through direct
contact with infected dogs or their reproductive or blood products.
Culture is the primary method for diagnosing B. canis in humans, but
it's complicated by low and intermittent bacteremia. Commercial
serological tests for smooth Brucella species may not detect B. canis
antibodies. Although canine serological tests have been adapted for
use in humans, their results should be interpreted with caution [24].
While dogs may initially test results positive, their serology values
can gradually decrease over time until they become negative [25].
In the present study, Pit Bull dogs were identied as subclinically
infected with B. canis, even though they displayed no clinical signs.
The presence of the pathogen was veried through serological and
molecular genetic screening. The incidence of B. canis infections
has risen in Turkey and other Countries, recently.
Studies have shown that 5.26–31.57% of dogs have tested
positive for B. canis using tube agglutination (TAT), while ELISA has
shown a prevalence of 2.12–15.78%. In a different study, B. canis
antibodies were discovered in 12 (0.8%) out of 1559 dog sera and 13
(5.8%) out of 225 human sera [26]. Symptoms of brucellosis from
B. canis in humans are similar to other Brucella species, with a risk
of death due to endocarditis or meningitis complications at a rate
of 2–5%. It is important to take precautions against contamination
[22]. The B. canis RM–666 ATCC 23365 standard strain was used
as a positive control. The standard serotype was provided by the
Department of Microbiology at Selcuk University Faculty of Veterinary
Medicine (Konya).
Genomic deoxyribonucleic acid (gDNA) was isolated from blood
samples and standard strains using a Genomic DNA Purication Kit®
(Thermo Fisher Scientic, Waltham, Massachusetts, USA), following the
manufacturer's protocol. The isolated genomic DNA was utilized as a
template for PCR amplication. The DNA samples were stored at -20°C in
a freezer (Bosch, Series 4, Germany) until they were ready for use in PCR.
B. canis species–specic PCR
B. canis–specic PCR procedures were performed according to the
protocol reported by Kang et al. [23]. Genomic DNA extracted from
each blood sample was amplied in a PCR reaction mixture (25 µL)
containing KCl containing 10X reaction buffer (Fermentas, Vilnius,
Lithuania), 1.75 mM MgCl
2
(Fermentas, Vilnius, Lithuania), 0.2 mM
each dNTP (Fermentas, Vilnius, Lithuania), 1 U Taq DNA polymerase
(Fermentas, Vilnius, Lithuania), 1 µL forward primer B. canis (10 pmol),
1 µL reverse primer B. canis (10 pmol) (Sentebiolab, Ankara, Turkey),
and 2 µL template DNA (10 pg–1 µg). PCR amplication was performed
using a thermal cycler (Mastercycler Personal; Eppendorf, Netheler,
Hinz GmbH, Hamburg, Germany). The PCR cycling parameters were
as follows: initial denaturation at 94°C for 7 min, followed by 35 cycles
of denaturation at 94°C for 35 s, annealing at 59°C for 40 s, extension
at 72°C for 35 s, and nal extension at 72°C for 5 min [23].
Agarose gel electrophoresis
PCR products were analyzed through 1.5% agarose gel
electrophoresis (Agarose–ME, Classic Type; Nacalai Tesque, Kyoto,
Japan) stained with ethidium bromide (AppliChem GmbH, Darmstadt,
Germany). The DNA bands were visualized using a gel documentation
system (Innity VX2, Strasbourg, France). Positive DNA samples were
scanned at 300 bp.
RESULTS AND DISCUSSION
Serologic identication
In this study, 35 Pit Bull dogs were analyzed for 2–ME RSAT and PCR
testing. Of the 35 blood serum samples analyzed, 13 (37.14%) were
found to be positive for 2–ME RSAT, while 22 (63%) were found to be
negative. Further analysis showed that 22.85% (8/35) of the 2–ME
RSAT positive dogs were female, while 14.28% (5/35) were male.
Molecular identication
To conrm the presence of B. canis infection, PCR testing was
applied to all samples, and 7 (20%) of the 2–ME RSAT positive
samples were found to be B. canis specic PCR positive. Agarose
gel electrophoresis micrograph were given in FIG. 2.
Of the 7 positive samples, 11.42% (4/35) belonged to female animals
and 8.58% (3/35) to male animals. Molecular and serological results
are shown in TABLE I.
Interestingly, 6 samples (4 females and 2 males) were found positive
(17.14%) by serological testing, but PCR testing did not conrm the
positivity. This was considered a result of potential cross–reactions
in serological tests.
TABLE I
The serological 2–ME RSAT and PCR test results of the Pit Bull
blood samples. 2–ME RSAT, 2–mercaptoethanol rapid slide
agglutination test; PCR, polymerase chain reaction
Pit Bull blood
samples (n=35)
Positive
Serological
positivity (%)
PCR positivity
(%)
2–ME RSAT PCR
Female 8 4 22.85 11.42
Male 5 3 14.28 8.58
TOTAL 13 7 37.14 20
Brucella canis in pit bull breed dogs/ Özavci et al. __________________________________________________________________________________
4 of 6
and transmission, as the potential for venereal contamination can
continue for at least two more years in dogs known to be healthy [26].
A higher prevalence of B. canis has been reported in stray dogs in
rural settings and on the streets. However, the prevalence of B. canis
infection in shelter dogs was reported as 2.3%, with a seroprevalence
of 17.8% [27]. The prevalence of B. canis seropositivity varies from 2 to
30% in different countries [28]. Studies in Brazil have used serological
surveys to identify cases of B. canis infection in dogs. Reports show
that seropositivity in dogs can range from 0 to 54.8% [29]. A study
in the United States found a seroprevalence of B. canis infection in
dogs of 6.8%, with age, breed and breeding history being risk factors
associated with the disease [30]. In Mississippi, a recent study found
a 2.3% prevalence of B. canis infection in shelter dogs [27]. Dogs in
Colombia had a seroprevalence of 1.96% for B. canis [31]. In Egypt,
research showed an apparent prevalence of 3.8% and an actual
prevalence of 13.2%, with stray dogs having a higher estimated true
prevalence of 15% compared to owned dogs at 12.5% [32]. Positive
B. canis antibodies were also found in studies conducted in Italy,
where 25 out of 2328 sera were positive (1.1%), and Brazil, where 72
out of 280 sera (25.7%) were positive results.
The prevalence of B. canis antibodies in dogs varies across different
countries. In Canada, out of 33 sera tested, 60.6% were positive,
with a range of 0.8 to 44.5%. In Argentina, 14.7% of 224 sera were
positive, while in Japan and Korea, 2.5 and 39.1% of 485 and 463
sera, respectively, were positive [33]. In Turkey, studies have shown
seroprevalence in dogs ranging from 5.4% and 7.7% [34]. Positive B.
canis antibodies were found in 7.7% of 362 sera by Oncel et al. [28], in
5.4% of 111 sera by Yılmaz and Gümüşsoy [33], in 6.3% of 222 samples
by Diker et al. [35], and in 6.7% of 134 sera by IstanBulluoğlu and Diker
[36]. A study found that dogs fed with leftovers and poor–quality
food had the highest prevalence of canine brucellosis (25%), while
dogs fed with commercial and formulated quality dog food had lower
prevalence values (0.19%) [37].
An epidemiological study of brucellosis among 415 domestic dogs
in Being, China, between 2006 and 2007 reported a seroprevalence
of 0.24%. Another study of domestic dogs in 2012–2013 reported an
incidence rate of 47% [22]. Pit Bull dogs have been found to have a
signicantly higher rate of seropositivity. In fact, it has been suggested
that males are more likely to be seropositive for B. canis than females,
while females may be more susceptible to seropositivity than males
[30]. However, in the current study, all seropositive dogs were either
neutered or spayed and the gender distribution was almost equal.
Therefore, gender was not considered to be an important factor in
the disaggregation of data. Due to transmission associated with
reproduction, it is normal for B. canis seroprevalence to be reduced
in neutered or spayed dogs. Also, when the results of the current study
were compared with those of previous studies, a lower proportion of
samples were found to be positive for B. canis antibodies. It was thought
that the change in the number of positive samples might be due to the
difference in the strains used to prepare the antigen.
The serological methods most commonly used to screen for B. canis
infection are the rapid slide agglutination test, the 2–mercaptoethanol
rapid slide agglutination test (2–ME RSAT), agar gel immunodiffusion
and ELISA [24]. The 2–ME RSAT can detect antibodies to B. canis in
serum samples from dogs [38]. However, this test has restrictions
such as low specicity and sensitivity [5, 24]. The limited humoral
response observed in dogs infected with B. canis may account for
this reduced sensitivity of serological tests. This may be due to
the intracellular nature of Brucella bacteria [39]. Also, treatment
of serum with 2–mercaptoethanol increases the specicity of the
test by destroying IgM pentamers, which can interfere with the
evaluation of IgG, but does not completely eliminate false positives
due to heterologous cross–reactions [24].
Molecular techniques are also often used to diagnose canine
brucellosis [5, 39]. PCR is a rapid sensitive, and specic test that
can be used on blood samples, semen samples from male dogs and
vaginal uid samples from female dogs. PCR can detect inactive
bacteria and is unaffected by other bacterial contaminants [40, 41].
However, several factors, including the presence of inhibitors, the
use of antibiotics and blood collection techniques involving heparin,
can reduce the sensitivity of PCR results [29]. The present study
demonstrated that the detection rates of B. canis antibodies in pit
Bull blood samples ranged from 22.85 to 20% when assessed by 2–
ME RSAT and PCR, respectively. Notably, six sera (17.14%) that were
initially positive by 2–ME RSAT were negative by PCR. In general, the
use of the 2–ME RSAT test for the diagnosis of brucellosis–positive
dogs increases the specicity of the test but may result in reduced
sensitivity and an increased number of negative results that may still
be present in the population [27]. The present diagnostic sensitivity
of 2ME–RSAT (37.14%) was similar to that reported by Keid et al. [39]
(31.76%) and Hensel et al. [24] (31.76–70%). When PCR was compared
with the 2ME–RSAT serological test, Keid et al. [41] stated that PCR
diagnostic sensitivity and specicity for the detection of B. canis DNA
in dog blood was 100%. Sensitivity and specicity results for PCR
and 2ME–RSAT are low due to the small number of dogs in our study.
However, our research has shown that the combination of 2ME–RSAT
and PCR as complementary diagnostic tools for canine brucellosis can
signicantly increase diagnostic accuracy. This nding also highlights
the potential to increase diagnostic accuracy through the synergistic
use of these tests. The RSAT test has a high sensitivity, resulting
in minimal false negative results. However, its lack of specicity is
known to contribute to frequent false–positive results. The reduced
humoral response observed in dogs infected with B. canis may offer
an explanation for the reduced sensitivity of serological tests, given
that Brucella are facultative intracellular organisms [39, 42].
Therefore, complementing the analysis with PCR testing is essential
to achieve accurate results. Several factors could contribute to the
discrepancy in test results, including possible infections at different
stages in the animals, the presence of different immunoglobulins in the
blood serum, or the occurrence of cross–reactions. Human infection with
B. canis is rare and self–limiting, with only an estimated 1% of diagnosed
cases of human brucellosis attributed to this agent [5]. Despite the
relatively low prevalence of brucellosis, dog breeders and veterinarians
must remain vigilant because of the associated public health risk.
CONCLUSIONS
This study concludes that the combination of the 2–ME RSAT test with
PCR is recommended to achieve accurate results and avoid false–positive
results in the serological diagnosis of B. canis infection in dogs. Although
2–ME RSAT is a widely used diagnostic method for canine brucellosis,
PCR–based assays offer higher sensitivity and specificity for the
detection of B. canis. In addition, PCR–based assays have demonstrated
good diagnostic performance for various sample types, making them a
valuable tool for the early and accurate diagnosis of canine brucellosis.
Further studies are needed to understand the prevalence and risk factors
associated with B. canis infection in Pit Bull dogs.
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33304
5 of 6
[13] Brower A, Okwumabua O, Massengill C, Muenks Q, Vanderloo
P, Duster M, Homb K, Kurth K. Investigation of the spread of
Brucella canis via the U.S. interstate dog trade. Int. J. Infect.
Dis. [Internet]. 2007; 11(5):454–458. doi: https://doi.org/c6dh6m
[14] Ghasemzadeh I, Namazi SH. Review of bacterial and viral zoonotic
infections transmitted by dogs. J. Med. Life. 2015; 8(4):1–5.
[15] Gorvel JP, Moreno E. Brucella intracellular life: from invasion
to intracellular replication. Vet. Microbiol. [Internet]. 2022;
90:281–297. doi: https://doi.org/bjzs
[16] Khalaf OH, Chaki SP, Garcia–Gonzalez DG. Interaction of
Brucella abortus with osteoclasts: a step toward understanding
osteoarticular brucellosis and vaccine safety. Infect. Immun.
[Internet]. 2020; 88: e00822–00819. doi: https://doi.org/48h8
[17] Roop RM, Barton IS, Hopersberger D, Martin DW. Uncovering
the hidden credentials of Brucella virulence. Mic. Mol. Biol. Rev.
[Internet]. 2021; 85:e00021–00019. doi: https://doi.org/gkz8tr
[18] Anyaoha CO, Majesty–Alukagberie LO, Ugochukwu ICI, Nwanta,
JA, Anene BM, Oboegbulam SI. Seroprevalence and risk factors
of brucellosis in dogs in Enugu and Anambra States, Nigeria. Rev.
Med. Vet. [Internet]. 2020; 40:45–59. doi: https://doi.org/kvcp
[19] Dentinger CM, Jacob K, Lee LV, Mendez HA, Chotikanatis K,
Mcdonough PL, Chico DM, De BK, Tiller RV, Traxler RM, Campagnolo
ER, Schmitt D, Guerra MA, Slavinski SA. Human Brucella canis
infection and subsequent laboratory exposures associated with a
puppy, New York City, 2012. Zoon. Public Health. [Internet]. 2015;
62(5):407–414. doi: https://doi.org/f7h4nk
[20] Carmichael LE, Greene CE. Infectious Diseases of the Dog and
Cat. 3
rd
. ed. St. Louis, Missouri, USA: Elsevier; 2006; p 573–584.
[21] Kim JW, Lee YJ, Han MY, Bae DH, Jung SC, Oh JS, Ha GW, Cho BK.
Evaluation of immuno–chromatographic assay for serodiagnosis
of Brucella canis. J. Vet. Med. Sci. [Internet]. 2007; 69(11):1103–
1107. doi: https://doi.org/fjd7wd
[22] Yan G, Pang Z, Hu Y, Zhou Z, Liu H, Luo Y, Zhong Z. First isolation
and multilocus sequence typing of Brucella canis from a
subclinically infected pet dog in China. Vet. Sci. [Internet]. 2022;
9:22. doi: https://doi.org/kvck
[23] Kang SI, Lee SE, Kim JY, Lee K, Kim JW, Lee HK, Sung SR, Heo
YR, Jung SC, Her M. A new Brucella canis species–specic PCR
assay for the diagnosis of canine brucellosis. Comp. Immunol.
Microbiol. Infect. Dis. [Internet]. 2014; 37:237–241. doi: https://
doi.org/gqrrp9
[24] Hensel ME, Negron M, Arenas–Gamboa AM. Brucellosis in dogs
and public health risk. Emerg. Infect. Dis. [Internet]. 2018;
24:1401–1406. doi: https://doi.org/gdzkcg
[25] Galarce N, Escobar B, Martinez E, Alvarado N, Peralta G, Dettleff
P, Dorner J, Martinez V, Borie C. Prevalence and genomic
characterization of Brucella canis strains isolated from kennels,
household and stray dogs in Chile. Anim. (Basel). [Internet].
2020; 10:2073. doi: https://doi.org/kvcm
[26] Sayan M, Erdenlig S, Etiler N. Sağlıklı kan donörlerinde Brucella
canis seropozitiiğinin laboratuvar yapımı lam aglütinasyon test
anteni ile araştırılması. Mikrobiyol. Bul. 2011; 45(4):655–63.
ACKNOWLEDGEMENTS
We would like to thank the employees of the enterprise and
veterinarians for their assistance in taking swab samples from the
Pit Bull dogs.
Conict of interest
The authors have no declaration of competing interests
BIBLIOGRAPHIC REFERENCES
[1] Alshehabat M, Obaidat M, Hayajneh W. Seroprevalence of Brucella
canis in dogs and at–risk humans in Jordan. Vet. Med. [Internet].
2019; 64:260–265. doi: https://doi.org/kvcc
[2] Andrade–Guzmán OS, Vallecillo AJ, Vintimilla–Rojas AE, Haro–
Haro AN, Agreda–Orellana IS, Vintimilla–Rojas DA, Rivera–Pirela
SE. Tipicación molecular de especies de Brucella en ganaderías
lecheras de la provincia del Azuay – Ecuador. Rev. Cient. Fac.
Cien. Vet. [Internet]. 2023; 33(1):1–8. doi: https://doi.org/kvcd
[3] Leclercq SO, Cloeckaert A, Zygmunt MS. Taxonomic organization of
the family brucellaceae based on a phylogenomic approach. Front.
Microbiol. [Internet]. 2020; 10:3083. doi: https://doi.org/kvcf
[4] Tuzcu N, Tuzcu M, Akcakavak G. Evaluation of tumor necrosis
factor alpha, interferon gamma, procalcitonin and neopterin
levels in Brucella seropositive cattle. Rev. Cientif. FCV–LUZ
[Internet]. 2023; 33:1–5. doi: https://doi.org/kvcg
[5] Santos RL, Souza TD, Mol JPS, Eckstein C, Paixão TA. Canine
Brucellosis: An update. Front. Vet. Sci. [Internet]. 2021;
8:594291. doi: https://doi.org/48rd
[6] Akinyemi KO, Fakorede CO, Amisu KO, Wareth G. Human and
animal brucellosis in Nigeria: A systemic review and meta–
analysis in the last twenty–one years (2001–2021). Vet. Sci.
[Internet]. 2022; 9:384. doi: https://doi.org/kvch
[7] Whitten TV, Brayshaw G, Patnayak D, Alvarez J, Larson CM, Root
KM, Holzbauer SM, Torrison J, Scheftel JM. Seroprevalence of
Brucella canis antibodies in dogs entering a Minnesota humane
society, Minnesota, 2016–2017. Prev. Vet. Med. [Internet]. 2019;
168:90–94. doi: https://doi.org/gqrrqg
[8] Tulu D. Bovine Brucellosis: Epidemiology, public health
implications, and status of brucellosis in Ethiopia. Vet. Med.
[Internet]. 2022; 7:21–30. doi: https://doi.org/gqxc9w
[9] Olsen SC, Palmer MV. Advancement of knowledge of Brucella over
the past 50 years. Vet. Pathol. [Internet]. 2014; 51:1076–1089.
doi: https://doi.org/gqtjd8
[10] Camargo–Castaneda AM, Stranahan LW, Edwards JF.
Characterization of epididymal and testicular histologic lesions
and use of immunohistochemistry and PCR on formalin–xed
tissues to detect Brucella canis in male dogs. J. Vet. Diagn.
Invest. [Internet]. 2021; 33:352–356. doi: https://doi.org/kvcj
[11] Baran A, Yağcioğlu S. Köpeklerde bruselloz ve klinisyen veteriner
hekimlikteki önemi. S.A.B.İ.A.D. 2018; 1:19–24.
[12] Cosford KL. Brucella canis: An update on research and clinical
management. J. Can. Vet. 2018; 59:74–81.
Brucella canis in pit bull breed dogs/ Özavci et al. __________________________________________________________________________________
6 of 6
[27] Hubbard K, Wang M, Smith DR. Seroprevalence of brucellosis
in Mississippi shelter dogs. Prev. Vet. Med. [Internet]. 2018;
159:82–86. doi: https://doi.org/gfmvh2
[28] Oncel Y, Akan M, Sareyyüpoğlu B, Tel OY, Çiftci A. Seroprevalance
of Brucella canis infection of dogs in two provinces in Turkey.
Turk. J. Vet. Anim. Sci. 2005; 29:779–783.
[29] Mol JPS, Guedes ACB, Eckstein C, Quintal APN, Souza TD, Mathias LA,
Haddad JPA, Paixão TA, Santos Rl. Diagnosis of canine brucellosis:
comparison of various serologic tests and PCR. J. Vet. Diagn. Invest.
[Internet]. 2020; 32:77–86. doi: https://doi.org/48qz
[30] Daly R, Willis KC, Wood J, Brown K, Brown D, Beguin–Strong T,
Ruesch H. Seroprevalence of Brucella canis in dogs rescued
from South Dakota Indian reservations; 2015–2019. Prev. Vet.
Med. [Internet]. 2020; 184:105157. doi: https://doi.org/kvcq
[31] Laverde AJ, Restrepo–Botero D, Hernández–Pulido D, Rodríguez–
Bautista JL, Sandoval IS. Seroprevalence of Brucella canis
in canines from a dog shelter in Bogotá, Colombia. Biomed.
[Internet]. 2021; 41:260–270. doi: https://doi.org/gqhc
[32] Hamdy ME, Abdel–Haleem MH, Dawod RE, Ismail RI, Hazem SS,
Fahmy HA, Abdel–Hamid NH. First seroprevalence and molecular
identication report of Brucella canis among dogs in Greater
Cairo region and Damietta Governorate of Egypt. Vet. World.
[Internet]. 2023; 16: 229–238. doi: https://doi.org/kvcr
[33] Yilmaz B, Gümüşsoy KS. Serological investigation of Brucella canis
infection of dogs in Kayseri province. Erciyes Med. J. 2010; 19:12–18.
[34] Goksel E, Parin U, Dolgun Ht, Kirkan S, Turkyilmaz S, Savasan
S. Investigation of the presence of Brucella canis in dogs in
western part of Turkey. Indian. J. Anim. Res. [Internet]. 2022;
56:619–623. doi: https://doi.org/kvcs
[35] Diker KS, Aydin N, Erdeger J, Ozyurt M. A serological of dogs
for Brucella canis and Brucella abortus and evaluation of
mercaptoethanol microaglutination test. Ank. Univ. Vet. Fak.
Derg. [Internet]. 1987; 34:268–277. doi: https://doi.org/kvct
[36] IstanBulluoğlu E, Diker S. Brucella canis üzerine serolojik
incelemeler. Ank. Univ. Vet. Fak. Derg. [Internet]. 1983; 30:14–18.
doi: https://doi.org/fcqt46
[37] Xiang F, Xia Z, Wu Q, Chen Y, Yu J, Wan J. Seroepidemiology of
canine brucellosis in Being, China. Turkish J. Vet. Anim. Sci.
[Internet]. 2013; 37:28–42. doi: https://doi.org/kvcv
[38] Godfroid J, Nielsen K, Saegerman C. Diagnosis of brucellosis in
livestock and wildlife. Croat. Med. J. [Internet]. 2010; 51:296–305.
doi: https://doi.org/fh4s8k
[39] Keid LB, Soares RM, Vasconcellos SA, Chiebao DP, Megid J, Salgado
VR, Richtzenhain LJ. Comparison of agar gel immunodiffusion
test, rapid slideagglutination test, microbiological culture and PCR
for the diagnosis of canine brucellosis. Res. Vet. Sci. [Internet].
2009; 86:22–26. doi: https://doi.org/dxgmfw
[40] Keid LB, Soares R.M, Vasconcellos SA, Chiebao DP, Megid J, Salgado
VR, Richtzenhain LJ. A polymerase chain reaction for the detection
of Brucella canis in semen of naturally infected dogs. Theriogenol.
[Internet]. 2007a; 67:1203–1210. doi: https://doi.org/bgkq2q
[41] Keid LB, Soares RM, Vasconcellos SA, Chiebao DP, Megid J,
Salgado VR, Richtzenhain LJ. Polymerase chain reaction for
detection of Brucella canis in vaginal swabs of naturally infected
bitches. Theriogenol. [Internet]. 2007b; 68:1260–1270. doi:
https://doi.org/drcmm7
[42] Johnson CA, Carter TD, Dunn JR, Baer SR, Schalow MM, Bellay YM,
Guerra MA, Frank NA. Investigation and characterization of Brucella
canis infections in pet–quality dogs and associated human exposures
during a 2007–2016 outbreak in Michigan. J. Am. Vet. Med. Assoc.
[Internet]. 2018; 253:322–336. doi: https://doi.org/gdw35v
