https://doi.org/10.52973/rcfcv-e33282
Received: 15/06/2023 Accepted: 11/09/2023 Published: 13/10/2023
1 of 8
Revista Científica, FCV-LUZ / Vol. XXXIII, rcfcv-e33282
ABSTRACT
The study was carried to investigate the effect of myo–inositol
supplementation on feed physicochemical structure and viral load of
dry cat food contaminated with inactive SARS–CoV–2 by simulating
sneezing. The most natural infection of severe acute respiratory
syndrome coronavirus 2 (SARS–CoV–2) in animals is related to close
contact with their owners with COVID–19 which is handling, taking
care and feeding them. SARS–CoV–2 can survive on food, fomites and
surfaces for extended periods related to environmental conditions.
Many natural feed additives and supplements have been a candidate
in recent antiviral treatment strategies against COVID–19. In this study,
myo–inositol which is permitted in animal nutrition was used at different
concentrations (0, 12.5, 25 and 50 mg·100 g
-1
cat food) and conditions
(22°C at room temperature and 4°C in the refrigerator) to investigate
its effects on feed physicochemical structure and viral load of dry cat
food contaminated with inactive SARS–CoV–2 by simulating sneezing.
For the interactions between myo–inositol, feed structure and viral load,
dry matter, moisture, water absorption index (WAI), water solubility
index (WSI), pH and virus gene copy (GC) by RT–qPCR were measured.
As only storage temperature affected both WAI and WSI as expected,
myo–inostol supplementation dose–dependently decreased gene copy
in dry cat food (IC
50
:366.4–581.5 mg·100 g
-1
cat food) at 22°C storage
temperature. Virus GC did not correlate with the dry matter, moisture
content, pH and WAI after the 30 min contact time (except WSI). In
conclusion, myo–inositol as a feed additive might have the potential
to control serious viral infections such as COVID–19 for human–animal
interactions in a One–Health context.
Key words: Myo–inositol; feed–borne; feed safety; SARS–CoV–2;
cat food
RESUMEN
Se llevo a cabo un experimento con el objetivo de estudiar el efecto de
alimento y la carga viral del alimento seco para gatos, contaminado
con SARS–CoV–2 inactivo, mediante la simulación de estornudos.
coronavirus 2 (SARS–CoV–2) en animales está relacionada con el
contacto cercano con sus dueños con el COVID–19 que es el manejo,
cuidado y alimentación de los mismos. El SARS–CoV–2 puede sobrevivir
en relación con las condiciones ambientales. Muchos aditivos y
suplementos naturales para piensos han sido candidatos en las recientes
estrategias de tratamiento antiviral contra el COVID–19. En este estudio,
se utilizó mio–inositol, que está permitido en la alimentación animal, en
diferentes concentraciones (0; 12,5; 25 y 50 mg·100 g
-1
de alimento para
viral del alimento seco para gatos contaminado con SARS–CoV–2
inactivo mediante la simulación de estornudos. Para las interacciones
entre el mioinositol, la estructura del alimento y la carga viral, se
virus (GC) por RT–qPCR. Como solo la temperatura de almacenamiento
afectó, tanto a WAI como a WSI como se esperaba, La suplementación
con mioinositol disminuyó de forma dependiente de la dosis la copia
genética en la comida seca para gatos en (IC50: 366,4–581,5 mg·100 g
-1
de comida para gatos) a una temperatura de almacenamiento de 22 °C.
La GC del virus no se correlacionó con la materia seca, el contenido
de humedad, el pH y el WAI después del tiempo de contacto de 30 min
(excepto WSI). En conclusión, el mioinositol como aditivo para piensos
la COVID–19 para las interacciones entre humanos y animales en un
contexto de One–Health.
Palabras clave: Alimento de gato; inocuidad de los alimentos;
mioinositol; transmisión por alimentos; SARS–CoV–2
The effect of myo–inositol supplementation on feed physicochemical
structure and viral load of dry cat food contaminated with SARS–CoV–2 by
simulating sneezing
Efecto de la suplementación con mioinositol en la estructura sicoquímica de la carga viral en
el alimento para gatos contaminados con SARS–CoV–2 mediante la simulación de estornudos
Serol Korkmaz
1,2
* , Ayşe Parmaksız
1
, Burcu Irem Omurtag–Korkmaz
3
, Ahmet Sait
1
1
Virology Laboratory, Pendik Veterinary Control Institute. Istanbul, Turkey.
2
Marmara University, Institute of Health Sciences, Biosafety and Biosecurity Program. Istanbul, Turkey.
3
Marmara University, Faculty of Health Sciences, Department of Nutrition and Dietetics. Istanbul, Turkey.
*corresponding author: serolkorkmaz@yahoo.com
The effect of myo-inositol on SARS-CoV-2 in dry cat food / Korkmaz et al. _________________________________________________________
2 of 8
INTRODUCTION
World Health Organization reported the severe acute respiratory
syndrome coronavirus 2 (SARS-CoV-2) spread and caused 659
million cases and 6.6 million deaths Worldwide [1]. The genomic
structure of this zoonotic virus is much closed among humans, wild
and domestic animals, however, the transmission routes have not
2, 3]. Also, the natural and experimental infections
of SARS-CoV-2 were demonstrated in wild domestic and captive
animals such as (companion animals) ferrets (Mustela putorius furo),
hamsters (Mesocricetus auratus) and household or stray cats (Felis
catus) through replication and shedding of the virus Ribonucleic acid
(RNA) [4, 5, 6]. The most natural SARS-CoV-2 infection in cats was
related to close contact with their owners infected with COVID-19
while handling, taking care and feeding them. Recent diagnostic,
serologic and also phylogenetic studies suggested that household
or stray cats can be infected by each other, other animal species
and humans [2, 3, 4, 5, 6]. In Thailand, the transmission by sneezing
was reported from cat to human, then veterinarian [2]. On the other
hand, experimental studies by intranasal inoculation presented the
SARS-CoV-2 replication in the gastrointestinal tract, upper and lower
respiratory tract, oronasal shedding for up to 9 days, and transmission
in cats which were co-housed with the infected cats [4, 7]. In the
studies on virus survival and stability in biological secretions (saliva,
mucus) and on fomites (plastic, steel, cotton, glass), SARS-CoV-2
can survive for extended periods related to the temperature and
humidity of storage conditions [8, 9, 10]. So, it is suspected that
shared cages, beds, litter boxes, food and water bowls might cause
indirect SARS-CoV-2 transmission from secretion, feed and fomites
to household cats or stray cats in shelters in close contact with each
other or person with COVID-19 [3, 4, 11, 12].
Recently, many natural compounds and new molecules are
addressed and targeted as candidate food/feed additives and
supplements in the antiviral treatment strategies and developing
therapeutic agents for COVID-19 [13, 14]. Polysaccharides from the
plant as a food/feed additive were suggested that they could have
potential activities against SARS-CoV-2 and highly contagious
viruses of animals including feline coronavirus, feline herpesvirus
1, feline influenza viruses, feline panleukopenia virus and feline
calicivirus of domestic cats [13, 15, 16, 17, 18]. Myo-inositol is a
natural polysaccharide synthesized by both animal and plant cells
and presented in all tissues as an essential component of biological
membranes and lung surfactant [19, 20]. Besides its polysaccharide
structure, myo-inositol is described as a nutritional additive as
[20, 21, 22]. But, there is a limited number of in vitro studies on the
antiviral activity of myo-inositol and its derivatives against highly
contagious and serious viruses with enveloped or non-enveloped
Deoxyribonucleic acid (DNA) and RNA genomes such as rhinovirus,
norovirus, Coxsackie virus, herpesvirus, HIV and iridovirus [23].
This study aimed to investigate the interaction of myo-inositol
content, storage condition, physicochemical structure and
SARS-CoV-2 load of dry cat food.
MATERIALS AND METHODS
Sample preparation
Myo–Inositol was in powder form and food grade with purity >0.98%
(Aromel Chem. Medical, Turkey) Packed dry cat foods which had the
same lot and part number were supplied from the retail market. The
manufacturer of the food declared that the food was for 2–12 month
aged kittens and did not supplement with inositol or its derivatives.
inositol powder was added at the concentrations of 0, 12.5, 25 and
-1
feed and mixed homogenously in an industrial food
mixer following each cleaning step.
Feed physicochemical analysis
h to determine the dry matter and moisture content of experimental
feeds supplemented with myo–inositol. Then, 1 g of dried feed samples
were weight in a tared centrifuge tube and 10 mL ultra–pure distilled
water was added at room temperature of 22°C and in the refrigerator
of 4°C (Antech, MPR–60, China). The tubes were inverted three times
in 10 min for 30 min. Then, all tubes were centrifuged (~1500 G, 25
min, Eppendorf 5804 Centrifuge, Germany). Each supernatant was
transferred to a tared aluminium foil and dried at 60°C for 12 h. The
pellets in the centrifuge tubes were weighted (Isolab, 602.31.001,
Germany) to calculate the water absorption index (WAI) and the water
solubility index (WSI) as follows;
()
WAI
g
g
Weight of pellet
Sample weight drybased
=
-
cm
(%)
()
suptan
WSI
Weight of dried erna t
Sample weight drybased
=
-
of feed sample in a 50 mL beaker. The suspension was stirred for 5
min and kept at 22°C at room temperature and 4°C in the refrigerator
for 1 h. After the separation of the solid phase from the suspension,
the pH of the aqueous phase was measured by a digital pH meter
(MW102, Milwaukee, USA).
Virus inoculation in cat food samples
A stock solution of inactivated SARS–CoV–2 virus was prepared
at the concentration of 2.1×10
8
gene copies·µL
-1
The stock solution was separated from the residual cell debris by
centrifuging and the supernatant was stored at -80°C (Thermo
analysis.
A plastic bottle sprayer was used in the BSL–2 cabinet to simulate
the virus contamination by sneezing and to spread the inactive virus
on feed homogeneously (FIG. 1). The virus stock solution was once
sprayed (300 µL) on feed sample surfaces of 100 g in triplicate and
thoroughly mixed in capped sterile 500 mL bottles. Each bottle
containing the virus–inoculated feed mixture was stored at room
temperature (21.8 ± 0.4°C) or 4 ± 0.5°C in a refrigerator for 30 min.
After the storage period at two different temperatures, 400 mL cold
Phosphate Buffered Saline (PBS) (pH 7.4) was added to each bottle to
make a 20% suspension and the bottles were inverted three times.
the aliquots were used for SARS–CoV–2 RT–qPCR assay.
FIGURE 1. Virus inoculation on the ground and sieved cat food by simulating
sneezing
FIGURE 2. The photograph of gel electrophoresis conrmation. Lanes 1 and 15:
ladder | Lanes 2, 3, 4: 12.5, 25 and 50 mg·100 g
-1
feed at 4°C | Lanes 5, 6, 7: 12.5, 25
and 50 mg·100 g
-1
feed at 22°C | Lanes 8, 9, 10, 11, 12: negative controls | Lanes
13 and 14: positive controls (72–67 bp) at 22°C and 4°C
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33282
3 of 8
Extraction and quantitation of total RNA in cat foods
A total nucleic acid isolation kit (Roche Diagnostics GmbH, Germany)
integrated with MagNa Pure LC LCPG 1170 (Roche Diagnostics GmbH,
Germany) device was used to isolate total nucleic acid from aliquots
buffer lysed cells and released nucleic acids. For the digestion of
proteins, the proteinase K enzyme was used. Then, released nucleic
acids bonded by adding MGP (magnetic glass particles). MGPs with
bound nucleic acids are magnetically separated from the residues
and washed with wash buffers to remove unbound substances like
proteins (nucleases), cell membranes, PCR inhibitors and salt. The
(GC) of SARS–CoV–2 in the extracts on same day.
The UV/VIS spectrophotometer (ND–1000, NanoDrop, Thermo Fisher
surfaces of the micro–spectrophotometer were cleaned by bathing
with sterile deionized water (2 µL) and wiping with a Kimwipe (Kimberly–
Clark Professional, USA) following each measurement. One microliter
nucleic acid extract (three replicates) was used to measure the total
RNA in three replicates. For the blank, sterile DNAse/RNAse–free
quality measurement of the nucleic acid extraction from feed samples.
RT–qPCR protocol and gel electrophoresis
real–time PCR diagnostic kit (Ref: KRM–136–002, V2, KrosQuanT,
Turkey) recommended by the World Health Organization (WHO),
China–CDC and USA–CDC [24]. Forward primers, reverse primers
and probes for two gene regions as N1 and N2 of SARS–CoV–2 were
designed as in TABLE I. The human RNAse P gene was used as the
internal control. The RT–qPCR assays were performed using the
Rotor–Gene Q (QIAGEN, Hilden, Germany). Thermal cycling conditions
consisted of RT at 45°C for 10 min, denaturation and Taq polymerase
activation at 95°C for 2 min and 45 cycles of 95°C for 10 s followed by
55°C for 30 s (data collection). RT–qPCR reactions were performed
copy in feed extracts was performed with the positive and negative
controls in the kit by generating the standard curve.
products were used with 1.5% (w/v) agarose gel stained by 2 µL
ethidium bromide (Invitrogen). The gel on the caster was kept at room
temperature for 20 min to be cool and solid. Then, it was transferred to
the wide gel electrophoresis system (Wide Mini Sub Gel integrated with
(1x). Five microliters of each PCR product, as well as a ladder marker,
The bands were imaged using a standard cellular phone camera on
(FIG. 2).
TABLE I
The primers and TaqMan probes used for the
RT–qPCR detection of SARS–CoV–2
Assay Name Function Sequence (5'––––3')
2019–nCoV_N1
(72 bp)
CDCN1–F Forward primer GACCCCAAAATCAGCGAAAT
CDCN1–R Reverse primer TCTGGTTACTGCCAGTTGAATCTG
CDCN1–P TaqMan probe ACCCCGCATTACGTTTGGTGGACC–
2019–nCoV_N2
(67 bp)
CDCN2–F Forward primer TTACAAACATTGGCCGCAAA
CDCN2–R Reverse primer GCGCGACATTCCGAAGAA
CDCN2–P TaqMan probe ACAATTTGCCCCCAGCGCTTCAG–
All probes were labelled with 5'–FAM and Q1 3'
Statistical analysis
The data analysis was conducted with parametric and non–
parametric methods by SPSS software version 15 software (IBM,
USA). The normality and homogeneity of variance were controlled
by Kolmogorov–Smirnov, Shapiro–Wilk and Levene’s Test. The
differences between groups were analysed by Kruskal Wallis test and
one–way ANOVA with post hoc Tukey. The general linear model (GLM)
was used to evaluate the effect of myo–inositol concentration and
total RNA content and gene copy of the virus as dependent variables.
The interaction between measurement parameters was exhibited by
was regarded as P<0.05. The tables and the graphs were generated
oft, USA).
The effect of myo-inositol on SARS-CoV-2 in dry cat food / Korkmaz et al. _________________________________________________________
4 of 8
RESULTS AND DISCUSSIONS
Physicochemical parameters of experimental cat foods
and pH properties of the samples containing different myo–inositol
concentrations and stored at both temperatures (TABLE II). While
myo–inositol supplementation did not affect WHC, WSI was
and WSI of all experimental foods (P<0.01, TABLE II). So, there was a
TABLE II
Physicochemical properties of cat food supplemented with myo–inositol
Myo–inositol
(mg·100 g
-1
feed)
Dry matter Moisture WHC WSI pH
4°C 22°C 4°C 22°C 4°C 22°C 4°C 22°C 4°C 22°C
Mean ± SD Mean ± SD Mean ± SD Mean ± SD Mean ± SD Mean ± SD Mean ± SD Mean ± SD Mean ± SD Mean ± SD
50 94.51 ± 0.06 94.51 ± 0.07 5.49 ± 0.06 5.49 ± 0.07 3.88 ± 0.11 3.37 ± .09 10.75 ± 0.01a 8.62 ± 0.01a 5.59 ± 0.03 5.61 ± 0.05
25 94.46 ± 0.04 94.50 ± 0.08 5.54 ± 0.04 5.50 ± 0.08 3.94 ± 0.10 3.37 ± 0.22 10.12 ± 1.08a 8.42 ± 0.35a 5.59 ± 0.03 5.62 ± 0.05
12.5 94.57 ± 0.05 94.48 ± 0.02 5.43 ± 0.05 5.52 ± 0.02 3.81 ± 0.38 3.68 ± 0.07 8.42 ± 0.35b 6.73 ± 0.22b 5.61 ± 0.06 5.63 ± 0.05
0 (Control) 94.61 ± 0.09 94.46 ± 0.04 5.39 ± 0.09 5.54 ± 0.04 3.76 ± 0.14 3.64 ± 0.14 8.02 ± 0.01b 6.62 ± 0.02b 5.58 ± 0.06 5.63 ± 0.15
P–value
Myo–inositol (A)
0.970 0.962 0.097 0.962 0.945 0.197 <0.01 <0.01 0.993 0.999
Storage Temp. (°C) (B) 0.084 0.084 <0.01 0.003 0.312
(A) × (B)
0.051 0.051 0.02 <0.01 0.911
TABLE III
The correlation coeciencies (β) between food parameters and viral load
β Coeciency
Storage
Temp. (°C)
Myo–inositol
Conc.
Gene Copy
(GC·mL
-1
)
Virus reduction
(%)
Dry matter (%) -0.343 -0.097 0.070 -0.124
Moisture (%) 0.343 0.097 -0.070 0.124
WHC -0.766** -0.094 0.422* 0.202
WSI (%) -0.556** 0.038 0.250 0.318
pH 0.207 0.065 -0.130 0.004
*
P<0.05; **P<0.01
The physicochemical properties of food such as nutritional content,
dry matter, moisture, humidity, water holding and pH can affect the
persistence, transmission and stability of possible feed–borne viruses
25, 26,
27, 28]. On complete feed and feedstuff with high moisture ingredients
porcine alpa– and delta–coronavriuses (PEDV, TGEV, PDCoV) were
longer stable and survived [27, 29]. It was suggested that PEDV
survived much better under cooler and high moisture conditions
than in warm and drier conditions [30]. Similarly, hepatitis A virus
(HAV) and porcine parvovirus (PPV) were tittered greater than 4 and
3.2 log in feed samples containing high moisture [31]. Also, African
swine fever virus (with DNA genome) survived at a higher titter in
moist cat and dog food than dry dog food and complete porcine
feed [25]. In this study, while myo–inositol supplementation did not
affect the physicochemical parameters, the storage temperature
determined between the feed structure and SARS–CoV–2 gene load
on dry cat food.
The quantication of total RNA
increasing the myo–inositol concentration in the feed at each storage
temperature compared with the control (P<0.01) (TABLE IV). Thus,
the storage temperature did not affect the total RNA content in the
isolates of the experimental feed (P=0.106). A260/A280 ratio indicates
the quality of RNA extraction and protein contamination level in
the isolates. Greater than 1.8 is generally considered an acceptable
extraction quality with low contamination and low inhibitor [32, 33].
The A260/A280 was calculated between 1.45 and 1.96.
The quantication of viral load by RT–qPCR
The gene copy of SARS–CoV–2 was significantly reduced by
increasing the concentration of myo–inositol in cat food (P<0.001)
and storage temperature (P=0.003). The highest relative reduction
(more than 50%) of virus GC was measured with 25 mg myo–inositol at
22°C and 50 mg myo–inositol at both 22°C and 4°C (P<
affect the virus gene copy in cat food at both storage conditions
compared with the others and the control food. As the virus GC
decreased significantly by increasing the storage temperature
(P=0.003), no interaction between myo–inositol concentration and
storage temperature for the gene copy of SARS–CoV–2 inoculated
storage temperatures on WHC and WSI as shown in TABLE II (P<0.05).
Dry matter, moisture content and pH of food samples did not
content, virus gene load and virus reduction rates after the 30 min
contact time (P>
the storage temperature with a negative correlation (P<0.01). And, a
positive–moderate correlation was determined between WHC and
virus gene load in food samples (P<0.05) independently of myo–inositol
content and virus reduction rate (TABLE III).
FIGURE 3. The reduction of SARS-CoV-2 gene copies by myo-inositol supplementation
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33282
5 of 8
in cat foods (P=0.185) was found. IC
50
was calculated as 366.4 mg and
581.5 mg myo–inositol/100 g feed for the storage conditions of 22°C
and 4°C respectively (FIG. 3).
(CV) (TABLE V). The precision (%CV) of the measurements at each level
should not exceed 15% [34, 35]. In this study, the calculated CV (%) for
each experimental feed was lower than the acceptance criteria of 15%.
Inositol or myo–inositol is an endogenous active substance and
is allowed to use as feed supplement. Although there are some
cat and dog nutrition, feed production and foodstuffs of animal origin
[20, 22, 36, 37]. European Food Safety Authority categorized inositol
as a nutritional additive (functional group: vitamins, pro–vitamins
food for dogs (Canis lupus familiaris) and cats on panel of additives
and products or substances used in animal feed (FEEDAP). The
FEEDAP Panel suggested that free inositol could be safe for dogs
and cats at the concentration of up to 3,000 mg free inositol·kg
-1
dry complete feed in commercial diets for pets [36]. In this study,
myo–inositol was used at recommended safe concentrations with a
maximum 500 mg·kg
-1
complete cat food (527.5 mg·kg
-1
based on dry
TABLE IV
The total RNA measured by the UV/VIS spectrophotometer
Myo–inositol
(mg·100 g
-1
feed)
Storage
Temp. (°C)
Total RNA
(mean±SD)
(ng·μL
-1
)
Abs. 260
(nm)
Abs. 280
(nm)
A260/A280
50
22°C
56.96±2.36
c
1.424 0.968 1.47
25 72.25±2.05
b
1.218 0.799 1.52
12.5 77.06±4.53
ab
1.926 1.327 1.45
0 (Control)
84.41±5.56
a
1.522 1.031 1.48
50
4°C
44.42±3.94
z
1.111 0.765 1.45
25 81.74±4.06
y
2.051 1.374 1.49
12.5 82.04±2.36
xy
2.043 1.369 1.49
0 (control) 91.17±3.10
x
2.28 1.162 1.96
Myo–inositol:
P<0.01, Temp: P=0.106, Myo–inositol*Temp: P=0.077
TABLE V
The effect of myo–inositol on viral load by RT–qPCR quantication
Myo–inositol
(mg·100 g
-1
feed)
Storage
Temp. (°C)
Inoculated
(GC·μL
-1
)
Recovered
(mean ± SD)
(GC·μL
-1
)
Ct CV (%)
Relative
Recovered (%)
Relative
Reduction (%)
IC50 (mg·100 g
-1
cat food)
50
22°C
16×10
5
3.8×10
4
± 1.6×10
3 b
24.10 ± 0.08 4.1 39.2 60.8
366.4
25 16×10
5
4.5×10
4
± 3.7×10
3 b
23.82 ± 0.14 8.3 46.4 53.6
12.5 16×10
5
8.9×10
4
± 7.6×10
3 a
22.81 ± 0.16 8.5 92.6 7.4
0 (control)
16×10
5
9.6×10
4
± 6.3×10
3 a
22.88 ± 0.05 6.6 100.0 0.0
50
4°C
16×10
5
5.9×10
4
± 5.3×10
3
y
23.38 ± 0.14 8.9 58.3 41.7
581.5
25 16×10
5
7.6×10
4
± 7.4×10
3
xy
22.98 ± 0.16 9.8 74.5 25.5
12.5 16×10
5
9.8×10
4
± 6.1×10
3
x
22.84 ± 0.12 6.2 96.9 3.1
0 (control) 16×10
5
10.0×10
4
± 3.4×10
3
x
22.78 ± 0.17 3.4 100.0 0.0
Myo–inositol:
P<0.001, Temp: P=0.003, Myo–inositol*Temp: P=0.228
matter of 94.5%). Previous studies have shown the antiviral effects
of inositol and its derivatives on mostly high contagious and serious
agents with DNA or RNA genomes [23, 39, 40]. Especially, at various
concentrations, it was effective in the inhibition of Coxsackie (non–
enveloped, RNA), Herpesviruses (enveloped, DNA). HIV (enveloped,
RNA), and Iridovirus (enveloped, RNA) threaten human and animal
health [23, 38, 39
50
than 50 µg·ml
-1
[39
-1
in vitro
the rate of up to 90% [40
IC
50
of 366.4 – 581.5 mg·100 g
-1
feed. Recent results had shown that
myo–inositol supplementation at safe concentration could have
the ability of dose–response inhibition of SARS–CoV–2 (enveloped,
RNA) contamination or persistency on cat food, independently of the
storage temperature and feed physicochemical structure.
Pets, especially cats, are still suspected of Covid–19 transmission
routes because of its zoonosis characteristic. Experimental and
The effect of myo-inositol on SARS-CoV-2 in dry cat food / Korkmaz et al. _________________________________________________________
6 of 8
epidemiological studies suggested the symptoms (sneezing, nasal
draining), transmission risk and immunity among stray or household
cats with COVID–19–positive owners [7, 41, 42]. The frequencies of
feeding, contacting such as kissing, grooming, handling of feed and
water bowls, surfaces and fomites which animal also has contacted
transmission of SAR–CoV–2 [42]. Moreover, the environmental
conditions such as temperature, humidity and surface material types
were also effective factors in the infectivity and lifespan of the virus.
At 20°C and more, the viability and half–life of SARS–CoV–2 sharply
decreased on many fomites and surfaces [8, 10, 43]. On surfaces such
as glass, stainless steel and both paper and polymer banknotes, the
half lives of SARS–CoV–2 were determined between 1.7 and 2.7 days
at 20°C, reducing to a few hours at 40°C [8]. In nasopharyngeal and
oropharyngeal liquids of the patients, SARS–CoV–2 was invective
in 46.2 % of patients. While after coughing, no infectious virus was
recovered, Viral recovery was high in intensive moistening with saliva
contaminating steel carriers So, its genome could be recovered
from high–moistening surfaces contacted with saliva [10]. Similarly,
SARS–CoV–2 maintained infectivity in foods with high protein, fat and
moisture such as raw meat for up to 14 days, but not in processed
food due to food additives and preservative contents [44]. The
dry cat food used in the study had very high dry matter (~95%) and
low moisture rates (~5%). Likewise the other studies, the viral load
that both myo–inositol supplementation as feed additive, temperature
and also WHC could have a role in the persistence of SARS–CoV–2
load on dry cat food.
CONCLUSION
Despite no difference in the physicochemical properties, myo–
inositol supplementation cause dose–response reduction of SARS–
CoV–2 gene load on cat food at both storage temperatures. So, while
more research is needed to fully understand the antiviral activity of
myo–inositol, recent results suggested that it may have the potential
as a feed additive to reduce the risk of zoonotic viral infections such
as COVID–19 for human–animal interactions in a One–Health context.
ACKNOWLEDGEMENT
The authors thank the Department and Research Laboratory of
Basic Health Sciences, Marmara University for supporting.
BIBLIOGRAPHICS REFERENCES
[1] World Health Organization. Coronavirus (COVID–19) Dashboard.
[Internet] 2023 [cited 17 Jun 2023]. 18 p. Available in: doi:
https://covid19.who.int/.
[2] Sila T, Sunghan J, Laochareonsuk W, Surasombatpattana
S, Kongkamol C, Ingviya T, Siripaitoon P, Kositpantawong N,
Kanchanasuwan S, Hortiwakul T, Charernmak B, Nwabor OF,
Silpapojakul K, Chusri S. Suspected Cat–to–Human Transmission
of SARS–CoV–2, Thailand, July–September 2021. Emerg. Infect.
Dis. [Internet]. 2022; 28:1485–8. doi: https://doi.org/grgdmv
[3] Costagliola A, Liguori G, D’angelo D, Costa C, Ciani F, Giordano A. Do
animals play a role in the transmission of severe acute respiratory
syndrome coronavirus–2 (SARS–CoV–2)? a commentary. Anim.
[Internet]. 2021; 11:1–11. doi: https://doi.org/ghswcz
[4] Bosco–Lauth AM, Hartwig AE, Porter SM, Gordy PW, Nehring M,
Byas AD, VandeWoude S, Ragan IK, Maison RM, Bowen RA.
Experimental infection of domestic dogs and cats with SARS–
CoV–2: Pathogenesis, transmission, and response to reexposure
in cats. Proc. Natl. Acad. Sci. [Internet]. 2020; 117:26382–8. doi:
https://doi.org/ghj9d7
Tan W, Wu G, Chen H, Bu Z, Bu Z. Susceptibility of ferrets, cats,
dogs, and other domesticated animals to SARS–coronavirus 2.
Sci. [Internet]. 2020; 368:1016–20. doi: https://doi.org/ggrj6s
[6] Hamer SA, Pauvolid–Corrêa A, Zecca IB, Davila E, Auckland LD,
Roundy CM, Tang W, Torchetti MK, Killian ML, Jenkins–Moore
M, Mozingo K, Akpalu Y, Ghai RR, Spengler JR, Behravesh CB,
Fischer RSB, Hamer GL. SARS–CoV–2 infections and viral
isolations among serially tested cats and dogs in households
Evaluation of the clinical evolution and transmission of SARS–CoV–2
infection in cats by simulating natural routes of infection. Vet. Res.
Commun. [Internet] 2022; 46:837–52. doi: https://doi.org/kwfk
[8] Riddell S, Goldie S, Hill A, Eagles D, Drew TW. The effect of
temperature on persistence of SARS–CoV–2 on common surfaces.
Virol. J. [Internet]. 2020; 17:1–7. doi: https://doi.org/ghfj2h
[9] Baker CA, Gibson KE. Persistence of SARS–CoV–2 on surfaces
and relevance to the food industry. Curr. Opin. Food Sci.
[Internet]. 2022; 47:100875. doi: https://doi.org/kwfm
[10] Meister TL, Dreismeier M, Blanco EV, Brüggemann Y, Heinen
N, Kampf G, Todt D, Nguyen HP, Steinmann J, Schmidt WE,
Steinmann E, Quast DR, Pfaender S. Risk of SARS–CoV–2
transmission by fomites: a clinical observational study in highly
infectious COVID–19 patients. Angew. Chemie Intern. [Internet].
2021; 119:361–416. doi: https://doi.org/kwfn
[11] Munoz–Fontela C, Dowling WE, Funnell SGP, Gsell PS, Riveros–Balta
Qin C, Crozier I, Dallmeier K, de Waal L, de Wit E, Delang L, Dohm
E, Duprex WP, Falzarano D, Finch CL, Frieman MB, Graham BS,
Gralinski LE, Guilfoyle K, Haagmans BL, Hamilton GA, Hartman
AL, Herfst S, Kaptein SJF, Klimstra WB, Knezevic I, Krause PR,
Kuhn JH, Le Grand R, Lewis MG, Liu WC, Maisonnasse P, McElroy
AK, Munster V, Oreshkova N, Rasmussen AL, Rocha–Pereira J,
Rockx B, Rodriguez E, Rogers TF, Salguero FJ, Schotsaert M,
Stittelaar KJ, Thibaut HJ, Tseng CT, Vergara–Alert J, Beer M,
Brasel T, Chan JFW, Garcia–Sastre A, Neyts J, Perlman S, Reed
DS, Richt JA, Roy CJ, Segales J, Vasan SS, Henao–Restrepo AM,
Barouch DH. Animal models for COVID–19. Nature. [Internet].
2020; 586:509–15. doi: https://doi.org/ghmtrm
[12] Segalés J, Puig M, Rodon J, Avila–Nieto C, Carrillo J, Cantero G,
Terrón MT, Cruz S, Parera M, Noguera–Julián M, Izquierdo–Useros
N, Guallar V, Vidal E, Valencia A, Blanco I, Blanco J, Clotet B,
Vergara–Alert J. Detection of SARS–CoV–2 in a cat owned by
a COVID–19–affected patient in Spain. Proc. Natl. Acad. Sci.
[Internet]. 2020; 117:24790–3. doi: https://doi.org/ghqhsp
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33282
7 of 8
[13] Mukherjee PK, Efferth T, Das B, Kar A, Ghosh S, Singha S, Debnath
P, Sharma N, Bhardwaj PK, Haldar PK. Role of medicinal plants in
inhibiting SARS–CoV–2 and in the management of post–COVID–19
complications. Phytomed. [Internet]. 2022; 98:153930. doi:
https://doi.org/gq84cr
[14] Chapman RL, Andurkar SV. A review of natural products, their
effects on SARS–CoV–2 and their utility as lead compounds in
the discovery of drugs for the treatment of COVID–19. Med. Chem.
Res. [Internet]. 2022; 31:40–51. doi: https://doi.org/gp4f6n
[15] Claus–Desbonnet H, Nikly E, Nalbantova V, Karcheva–
Bahchevanska D, Ivanova S, Pierre G, Benbassat N, Katsarov
P, Michaud P, Lukova P, Delattre C. Polysaccharides and their
derivatives as potential antiviral molecules. Viruses. [Internet].
2022; 14(2):1–26. doi: https://doi.org/kwgr
polysaccharide with broad–spectrum antiviral activity against
multi–feline viruses. Intern. J. Biol. Macromol. [Internet]. 2017;
95:160–7. doi: https://doi.org/kwgs
[17] Jaber N, Al–Remawi M, Al–Akayleh F, Al–Muhtaseb N, Al–Adham
ISI, Collier PJ. A review of the antiviral activity of Chitosan,
including patented applications and its potential use against
COVID–19. J. Appl. Microbiol. [Internet]. 2022; 132:41–58. doi:
https://doi.org/kwgt
polysaccharides in the development of anti–novel coronavirus
drugs and vaccines. Intern. J. Biol. Macromol. [Internet]. 2020;
164:331–43. doi: https://doi.org/gg42r4
[19] Li S, Zhao F, Ye J, Li K, Wang Q, Du Z, Yue Q, Wang S, Wu Q, Chen
H. Cellular metabolic basis of altered immunity in the lungs of
patients with COVID–19. Med. Microbiol. Immunol. [Internet].
2022; 211:49–69. doi: https://doi.org/kwgv
and cats. EFSA. J. [Internet]. 2014; 12(5):3671. doi: https://doi.
org/kwgw
of inositol as nutritional additive for dogs and cats. EFSA. J.
[Internet]. 2016; 14(6): e04511. doi: https://doi.org/kwgx
[22]
[Internet]. 2021 [Accessed 8 Jun 2023]; 237 p. Available in: doi:
https://doi.org/kwg3
of Inositol (Vitamin B8) as a Dietary Supplement in Human and
Animal Nutrition. J. Heal. Sci. Manag. [Internet]. 2022; 2:68–72.
doi: https://doi.org/kwg4
[24] Centers for Disease Control and Prevention (CDC). 2019–novel
coronavirus (2019–nCoV) real–time rRT–PCR panel primers and
probes 2020. [Internet]. 2023 [cited 17 Jun 2023]; 66 p. Available
in: https://bit.ly/45acud6
Rowland RRR, Niederwerder MC. Half–life of African swine
fever virus in shipped feed. Emerg. Infect. Dis. [Internet]. 2019;
25:2261–3. doi: https://doi.org/kwg5
[26] Caserta CL, Jessica JC, Singrey A, Niederwerder MC, Dee S, Nelson
EA, Diel DG. Stability of Senecavirus A in animal feed ingredients and
infection following consumption of contaminated feed. Transbound.
Emerg. Dis. [Internet]. 2022; 69:88–96. doi: https://doi.org/kwg6
[27] Trudeau MP, Verma H, Sampedro F, Urriola PE, Shurson GC, Goyal
SM. Environmental persistence of porcine coronaviruses in feed
and feed ingredients. PLoS One. [Internet]. 2017; 12:1–12. doi:
https://doi.org/f9832f
[28] Shurson GC, Palowski A, van de Ligt JLG, Schroeder DC, Balestreri
C, Urriola PE, Sampedro F. New perspectives for evaluating
relative risks of African swine fever virus contamination in global
feed ingredient supply chains. Transb. Emerg. Dis. [Internet].
2022; 69:31–56. doi: https://doi.org/gkcc6b
[29] Gebhardt JT, Woodworth JC, Jones CK, Tokach MD, Gauger
PC, Main RG, Zhang J, Chen Q, Derouchey JM, Goodband RD,
Stark CR, Bergstrom JR, Bai J, Dritz SS. Determining the
impact of commercial feed additives as potential porcine
epidemic diarrhea virus mitigation strategies as determined
by polymerase chain reaction analysis and bioassay. Transl.
PE. Guidelines for developing a risk–based plan to mitigate virus
transmission from imported feed ingredients. University of
Minnesota. [Internet]. 2019 [cited 17 Jun 2023]; 44 p. Available
in: https://bit.ly/3rwLVRp.
[31] Savage M, Torres J, Franks L, Masecar B, Hotta J. Determination
of adequate moisture content for efficient dry–heat viral
inactivation in lyophilized factor VIII by loss on drying and by
near infrared spectroscopy. Biol. [Internet]. 1998; 26(2): 119–124.
doi: https://doi.org/bf5tsc
[32] Glišin V, Crkvenjakov R, Byus C. Ribonucleic acid isolated by
cesium chloride centrifugation. Biochem. [Internet]. 1974; 13(12):
2633–2637. doi: https://doi.org/dj2dx8
[33] Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation
of Biologically Active Ribonucleic Acid from Sources Enriched
in Ribonuclease. Biochem. [Internet]. 1979; 18(24): 5294–5299.
doi: https://doi.org/dvw6f5
[34] European Medicines Agency. Guideline on bioanalytical method
validation. [Internet]. 2015 [cited 17 Jun 2023]; 23 p. Available
in: https://bit.ly/3tfyAO5.
[35] Food and Drug Administration (FDA). Bioanalytical Method
Validation Guidance for Industry Bioanalytical Method Validation
Available in: https://bit.ly/46tyjFt.
of inositol as nutritional additive for dogs and cats. EFSA J.
[Internet]. 2016; 14 (6): e04511. doi: https://doi.org/kwgx
The effect of myo-inositol on SARS-CoV-2 in dry cat food / Korkmaz et al. _________________________________________________________
8 of 8
[37] European Commission. Commision Regulation (EU) No 37/2010
of 22 December 2009 on pharmacologically active substances
foodstuffs of animal origin. Off. J. Eur. Union. [Internet]. 2009
[cited 17 Jun 2023]; 89 p. Available in: https://bit.ly/3rrIj3l.
[38] Baranova EO, Shastina NS, Lobach OA, Chataeva MS, Nosik DN,
Shvets VI. Activity of the inositol–containing phospholipid dimer
[Internet]. 2014 [cited 17 Jun 2023]; 59(1):34–38. Available in:
https://bit.ly/3F13uMO. PMID: 25065144.
[39] Tuchnaya OA, Gorlachuk OV, Livshits VA, Kashiricheva II, Shastina
NS, Yurkevich AM, Shvets VI. Synthesis of anionic derivatives of
myo–inositol and other polyols and investigation of their antiviral
activity. Pharm. Chem. J. [Internet]. 2008; 42:4–10. doi: https://
doi.org/dsv69c
activities of Lonicera japonica Thunb. Components against
grouper iridovirus in vitro and in vivo. Aquaculture. [Internet].
2020; 30:519. doi: https://doi.org/kwkx
[41] Kuhlmeier E, Chan T, Klaus J, Pineroli B, Geisser E, Hofmann–
Lehmann R, Meli ML. A Pre–and Within–Pandemic Survey of
SARS–CoV–2 RNA in Saliva Swabs from Stray Cats in Switzerland.
Viruses. [Internet]. 2022; 14:1–9. doi: https://doi.org/kwkt
[42] Kuhlmeier E, Chan T, Meli ML, Willi B, Wolfensberger A, Reitt
K, Hüttl J, Jones S, Tyson G, Hosie MJ, Zablotski Y, Hofmann–
Lehmann R. A Risk Factor Analysis of SARS–CoV–2 Infection in
Animals in COVID–19–Affected Households. Viruses. [Internet].
2023; 15(3):731. doi: https://doi.org/kwkv
[43] Wang J, Tang K, Feng K, Lv W. High Temperature and High
Humidity Reduce the Transmission of COVID–19. BMJ Open.
[Internet]. 2020. 11(2): e043863. doi: doi: https://doi.org/ggpwxx
[44] Jia M, Taylor TM, Senger SM, Ovissipour R, Bertke AS. SARS–
CoV–2 Remains Infectious on Refrigerated Deli Food, Meats,
and Fresh Produce for up to 21 Days. Foods. [Internet]. 2022;
11:1–15. doi: https://doi.org/kwkw
