https://doi.org/10.52973/rcfcv-e34456
Received: 23/05/2024 Accepted: 11/07/2024 Published: 07/10/2024
1 of 7
Revista Científica, FCV-LUZ / Vol. XXXIV, rcfcv-e34456
ABSTRACT
Unfortunately, global warming, especially the global climate crisis,
increases the rate of vector–borne infections. Among the causes of
this infection are microorganisms in the Rickettsiales Order, which
are Gram–negative and small coccobacillus microorganisms that can
multiply within host cells and are dependent on their metabolism, in
addition to bacterial infections, protozoa such as Babesia spp. and
Theileria spp. are transmitted through vectors and cause serious
diseases in animals. This study aimed to investigate the presence of
some vector–borne bacterial and protozoan microorganisms in blood
samples taken from cattle raised in Mugla province, located in the
West of Türkiye, and to reveal relevant disease data for the region. In
this study, blood samples taken from 100 cattle were examined using
molecular methods. While Anaplasma phagocytophilum was detected
in 15 blood samples (15%), Anaplasma ovis agent was detected in
eight samples (8%). Anaplasma bovis agent (1%) was identied in
only one blood sample. In the samples examined within the scope
of the study, Ehrlichia and Rickettsia species from bacteria and
Theileria spp. and Babesia spp. from parasitic agents could not be
detected. Mugla province, located west of Türkiye, has a subtropical
dry summer climate, so the probability of infections transmitted
through arthropods is high. Since the agents are transmitted through
ticks, conducting more studies on vector–borne diseases is essential.
This includes mapping the region’s vector ticks and determining
and evaluating the tick carrier and disease maps in cattle. The data
obtained is thought to help create regional and national vector–borne
disease maps.
Key words: Anaplasma spp.; Babesia spp.; Ehrlichia spp.;
Rickettsiaspp.; Theileria spp.
RESUMEN
Desafortunadamente, el calentamiento global, especialmente la
crisis climática global, aumenta la tasa de infecciones transmitidas
por vectores. Entre las causas de esta infección se encuentran
microorganismos del Orden Rickettsiales, que son microorganismos
Gram negativos y cocobacilos pequeños que pueden multiplicarse
dentro de las células huésped y son dependiente de su metabolismo
las, además de infecciones bacterianas, protozoos como
Babesiaspp. y Theileria spp. se transmiten a través de vectores y
causan enfermedades graves en los animales. Este estudio tuvo
como objetivo investigar la presencia de algunos microorganismos
bacterianos y protozoarios transmitidos por vectores en muestras de
sangre tomadas de ganado criado en la provincia de Mugla, ubicada
en el oeste de Turquía, y revelar datos relevantes sobre enfermedades
para la región. En este estudio, se tomaron muestras de sangre de 100
bovinos y se examinaron mediante métodos moleculares. Mientras
que Anaplasma phagocytophilum se detectó en 15 muestras de sangre
(15%), el agente Anaplasma ovis se detectó en ocho muestras (8%).
El agente Anaplasma bovis (1%) fue identicado en una sola muestra
de sangre. En las muestras examinadas en el marco del estudio no se
pudieron detectar especies de bacterias como Ehrlichia y Rickettsia
y de parásitos como Theileria spp. y Babesia spp. La provincia de
Mugla, situada al oeste de Türkiye, tiene un clima estival seco
subtropical, por lo que la probabilidad de infecciones transmitidas
a través de artrópodos es alta. Dado que los agentes se transmiten
a través de las garrapatas, es esencial realizar más estudios sobre
las enfermedades transmitidas por vectores. Esto incluye mapear las
garrapatas vectoras de la región y determinar y evaluar los mapas de
portadores de garrapatas y enfermedades en el ganado. Se cree que
los datos obtenidos ayudarán a crear mapas regionales y nacionales
de enfermedades transmitidas por vectores.
Palabras clave: Anaplasma spp.; Babesia spp.; Ehrlichia spp.;
Rickettsia spp.; Theileria spp.
Molecular study of some vector–borne diseases in cattle raised in western Türkiye
Investigación molecular de algunas enfermedades transmitidas por
vectores en ganado vacuno criado en el oeste de Turquía
Semiha Yalçın
1
, Neslihan Sürsal Şimşek
2
, Seyda Cengiz
1
*
1
Mugla Sitki Kocman University, Milas Faculty of Veterinary Medicine, Department of Preclinical Sciences, Department of Microbiology. Mugla, Türkiye.
2
Mugla Sitki Kocman University, Milas Faculty of Veterinary Medicine, Department of Preclinical Sciences, Department of Parasitology. Mugla, Türkiye.
*Correspondence Author: seydacengiz@mu.edu.tr
Vector-borne diseases in cattle / Yalçın et al. _______________________________________________________________________________________
2 of 7
INTRODUCTION
Vector–borne diseases have been increasing in recent years, and
global climate change and animal population movements are particularly
effective in spreading such diseases. These infections occur especially
in tropical and subtropical areas and are also seen in our country [1].
Microorganisms in the Order Rickettsiales, which cause infections
transmitted through arthropods, are small coccobacilli that can multiply
in host cells and show Gram–negative properties [2]. Rickettsia species
belonging to the Rickettsiaceae family and Anaplasma and Ehrlichia
species belonging to the Anaplasmataceae family, within the Order
Rickettsiales [3], are important pathogens for farm animals. They are
important for animal and public health because they contain some
species that can cause human infection [4]. They are bacteria that
settle in endothelial cells, immune system cells or erythrocytes, have
obligate intracellular properties and are transmitted through blood [5].
Anaplasmosis is a bacterial infection that causes serious economic
losses in animal husbandry and is also important for public health.
Transmission is caused by the genera Ixodes, Dermacentor, Rhipicephalus
and Amblyomma ticks. The infection is caused by Anaplasma spp. and
infects the red blood cells of vertebrates [6]. The agent is transmitted
biologically by ticks, mechanically by ies and contaminated materials.
The pathogenic species in cattle is A. marginale [7]. In addition to
this species, A. centrale, A. bovis, A. ovis, A. phagocytophilum and A.
platys cause infection dened as Anaplasmosis in cattle [8, 9, 10].
Ehrlichiosis is a disease caused by species of the Ehrlichia genus.
Ehrlichia species settle intracytoplasmically in the leukocytes of their
host [11]. Ehrlichiosis in cattle can be accompanied by fever, protruding
tongue, oppy ears, turning around, excessive chewing, decreased feed
consumption, conjunctival congestion and lymphadenitis symptoms
[12, 13]. Bovine Ehrlichiosis is mainly caused by E. ruminantium.
Transmission occurs from ticks of the genus Amblyomma, especially
A. variegatum and A. habraeum [12]. Forms of the disease that progress
with high mortality within a few hours in the peracute form and within
36–48 hours in the acute form have been reported [13].
Rickettsia genus bacteria has two main groups: the spotted fever
group and the typhus group. In humans, infections from the spotted
fever group can cause symptoms ranging from mild, like fever and
rash, to life–threatening, depending on the specic agent. In ruminant
animals, the infection tends to be self–limiting; therefore, Rickettsia
infection has not received much attention in these animals [14, 15].
The primary vector of diseases in the spotted fever group is infected
ticks. While various tick species of the Dermacentor, Rhipicephalus,
and Amblyomma genera serve as vectors for R. rickettsii in America,
Rhipicephalus sanguineus has been associated with R. conorii in
Europe and the Mediterranean coasts, and Amblyomma ticks have
been associated with R. africae in Africa. In Asia, R. japonica has
been frequently isolated from various tick species belonging to the
Haemaphysalis, Ixodes and Dermacentor genera [16].
The most common protozoan diseases transmitted by vectors in
cattle are caused by Babesia and Theileria species [17, 18]. Babesiosis
is an important parasitic disease for both animal and public health
[19]. Babesia agents reproduce asexually within the erythrocytes of
mammals, and the erythrocytic forms are called piroplasm. Sexual
reproduction of the agent occurs in ticks in the Ixodidae family [20].
Bovine babesiosis is also commonly called Texas Fever or Blood
Urination Disease. Babesia bovis, B. bigemina and B. divergens species
cause clinical babesiosis in cattle [21, 22]. Babesia infections are
inuenced by the host’s age, immune system, co–infection status, and
genetic factors. Symptoms of acute infection include fever, anemia,
hemoglobinuria, jaundice, weakness, lethargy, and anorexia, while
chronic infection may be asymptomatic [20, 23].
Theileriosis is caused by Theileria agents, which are obligate
intracellular protozoa mostly affecting ruminants and transmitted by
ticks. The infection process involves entering the agents into the host’s
lymphocyte or macrophage cells, followed by asexual proliferation and
development into piroplasmic forms found in erythrocytes at a later
stage [24]. Theileria species are transmitted by ticks of the genus
Hyalomma, Rhipicephalus, Dermacentor, Haemaphysalis, Amblyomma
in the family Ixodidae, and ticks of the genus Ornithodorus in the family
Argasidae. Especially T. parva (East Coast Fever) and T. annulata (Tropical
theileriosis) are highly pathogenic species and can cause clinical disease
in cattle. Symptoms may vary depending on factors such as infection with
the pathogenic Theileria agent, tick infestation severity, other pathogen
infections, host’s immune system, age, race, and vaccination status [25].
The rst symptom after a tick starts sucking blood is fever, followed by an
enlargement of the nearest lymph node. Later symptoms include loss of
appetite, increased heart rate, weakness, petechial bleeding, edema in
the lymph and eyelids, decreased milk yield, and jaundice [26]. Although
various studies have been conducted on the molecular epidemiology
of diseases caused by vector–borne Rickettsial pathogens in cattle in
Türkiye, there is still a lack of information regarding these factors [1]. In
the Mugla region, which is included in the scope of the study, no studies
on these diseases in cattle were found. This study aimed to investigate
Anaplasma, Ehrlichia and Rickettsia, Babesia and Theileria species using
molecular methods in blood samples taken from cattle raised in Mugla
province, located in the west of Türkiye.
MATERIALS AND METHODS
Sampling
Blood samples were collected from apparently healthy dairy cattle
between June and September 2023, when vector ticks were also
active. A total of 100 cattle (Bos taurus) blood samples taken from
11 different farms were used as material. Blood samples were taken
from the jugular veins of the animals into 10 mL tubes with di–sodium
ethylenediamine tetra–acetate (EDTA) under aseptic conditions.
Then, each blood sample collected was divided into sterile 1.5 mL
eppendorf tubes and stored at -20°C (Grundig, GRNE 4302, Türkiye)
until genomic DNA isolations were performed.
DNA extraction and molecular analysis
200 μL of blood was used to isolate genomic DNA (gDNA) from the blood
sample taken from each cattle. At this stage, analyses were performed
using a commercial kit (GeneJET Genomic DNA Purication Kit, Thermo
Scientic, Waltham, MA, USA) in accordance with the manufacturer’s
instructions. The gDNAs obtained were stored at -20°C until PCR analysis.
Three different multiplex–PCR reactions (Rxn) were performed
for bacteria A. centrale and A. marginale (Rxn1) [27], Ehrlichia spp.
and Rickettsia spp. (Rxn2) [28], A. capra, A. bovis, A. ovis and A.
phagocytophilum (Rxn3) (TABLE I) [29]. Ready–made PCR mix was used
for multiplex PCR processes (DreamTaq Hot Start Green PCR Master
Mix, Thermo Scientic, Waltham, MA, USA). Rxn1 was programmed as
follows: 3 min at 95°C, 10 s at 98°C, 30 s at 55 °C, 30 s at 72°C (35cycles)
and a nal extension at 72°C for 5 min. Rxn2 was programmed as
follows: 95°C for 1 min, 95°C for 30 s, 56 °C for 30 s, 72°C for 30s
(40 cycles), and a nal extension of 72°C for 7 min. Amplication
TABLE I
Primer sequences used in molecular analyses of bacterial agents
Agent Oligonucleotide sequence
Amplicon
size (bp)
Anaplasma
centrale
F: CATGGGGCATGAATCTGTG
R: AATTGGTTGCAGTGAGCGC
395
Anaplasma
marginale
F: CATCTCCCATGAGTCACGAAGTGGC
R: GCTGAACAGGAATCTTGCTCC
761
F: GCATTACAACGCAACGCTT
R: ACCTTGGAGCGCATCTCTT
515–687
Ehrlichia spp.
F: CAATAGCAAGAGCCAATG
R: TTAGAAGATGCTGTAGGATG
145
Rickettsia spp.
F: CAGACTTACCAAACTCAATC
R: TACGCAAGAACCCTTGGA
437
Anaplasma
capra
groE: TGAAGAGCATCAAACCCGAAG 874
Anaplasma
bovis
groE: CTGCTCGTGATGCTATCGG
groE: GTGGGATGTACTGCTGGACC
529
Anaplasma
ovis
msp4: ATGGGGAGAGATATCCGCGA
msp4: TGAAGGGAGCGGGGTCATGGG
347
Anaplasma
phagocytophilum
16SrRNA:
GAGTAATTGCAGCCAGGCACTCT
AGTGCTGAATGTGGGGATAATTTATCTCCGTG
CTAATCTCCATGTCAAGGAGTGGTAAGGTTT
172
TABLE II
The microorganisms detected by molecular method in blood samples
Farm code Sample no Bacterial agent
A
A1
Anaplasma phagocytophilum
Anaplasma ovis
A4
Anaplasma phagocytophilum
Anaplasma ovis
A5
Anaplasma phagocytophilum
B
B1
Anaplasma bovis
B3 Anaplasma ovis
B4
Anaplasma phagocytophilum
D D4 Anaplasma ovis
E
E1
Anaplasma phagocytophilum
Anaplasma ovis
E4 Anaplasma phagocytophilum
E5
Anaplasma phagocytophilum
Anaplasma ovis
E8 Anaplasma phagocytophilum
E9 Anaplasma phagocytophilum
E12 Anaplasma phagocytophilum
E15
Anaplasma phagocytophilum
F F2 Anaplasma phagocytophilum
G
G1
Anaplasma phagocytophilum
Anaplasma ovis
G5
Anaplasma phagocytophilum
Anaplasma ovis
M
M13
Anaplasma phagocytophilum
FIGURE 1. Gel electrophoresis image of Anaplasma phagocytophilum and Anaplasma
ovis. 1: Negative control; 2, 4, 5, 6: Positive samples (A. phagocytophilum and A.
ovis); 3: Negative sample; M: Marker DNA Ladder Plus
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34456
3 of 7
conditions for Rxn3 were performed under the following 5 min at 94°C,
30 s at 94°C, 30 s at 63°C, 1 min at 72°C (35 cycles), and extension 1
min at 72°C conditions.
PCR was performed with specific primers Forward
3’–GACACAGGGAGGTAGTGACAAG–5’ and Reverse 5’–
CTAAGAATTTCACCTCTGACAGT–3’ [30], which amplify approximately
403 bais pair (bp) of the 18S ribosomal rRNA (V4 hypervariable region)
gene of Babesia spp. and Theileria spp. The reaction mixture should be
25 μL in accordance with the manufacturer’s recommendation; 12.5
μL of commercial master mix (DreamTaq Hot Start Green PCR Master
Mix, Thermo Scientic, Waltham, MA, USA) was prepared by adding
0.5 μM of each primer and 10–50 nanograms (ng) of genomic DNA
(gDNA). The thermal prole is 2 min at 95°C; 35 cycles, denaturation:
30 s at 95°C, binding: 30 s at 57°C, extension: 1 min at 72°C, and
nal extension: 10 min at 72°C. The obtained PCR products were
subjected to electrophoresis in 1.5% agarose gel and visualised in a
UV transilluminator (Cleaver, Clear View, United Kingdom).
RESULTS AND DISCUSSION
Rickettsia spp. and Ehrlichia spp. could not be detected in all cattle
blood samples collected from 11 different farms. Bacterial agents
belonging to the Anaplasma genus were detected by molecular
methods in 7 cattle farms. At least one Anaplasma spp. agent was
detected in 18% of all cattle blood samples. While A. phagocytophilum
was detected in fteen blood samples (15%), the A. ovis agent was
molecularly determined in eight samples (8%). Among these samples,
A. phagocytophilum and A. ovis bacteria were molecularly detected as
mixed infections in blood samples from six different cattle. A. bovis
agent (1%) was identied in a blood sample from cattle (FIGS. 1 and 2).
Theileria spp. and Babesia spp. could not be detected in the samples
examined within the scope of the study. Information on bacterial
agents detected molecularly in blood samples is given in TABLE II.
FIGURE 2. Gel electrophoresis image of Anaplasma phagocytophilum and
Anaplasma bovis. 1: Negative Control; 3: A. phagocytophilum; 4: A. bovis; M: Marker
DNA Ladder Plus
Vector-borne diseases in cattle / Yalçın et al. _______________________________________________________________________________________
4 of 7
Due to climate change, global warming and increased humidity have
enlarged the number of vectors, resulting in a rise in the incidence
of vector–borne infections. These infections adversely affect cattle
farming, causing economic losses by reducing productivity and
even resulting in deaths worldwide [31]. Vector–borne infections
can be detected through Giemsa–stained blood smear examinations
and serological tests. However, microscopic examination can be
misinterpreted, and serological tests can result in cross–reaction,
leading to inaccurate diagnoses. As an alternative to traditional
diagnosis, molecular techniques such as PCR are becoming more
widespread due to their higher sensitivity and specicity, providing
an accurate diagnosis [31, 32].
Anaplasma agents, clinically most evident in cattle but can also
infect other ruminant animals, are transmitted mechanically through
fly bites, ticks, and surgical procedures such as dehorning and
castration [33]. The main causative agent of bovine anaplasmosis
is A. marginale [33, 34, 35]. Cattle that recover from infection remain
permanently infected carriers and become a reservoir for other
cattle [35]. Acute anaplasmosis is diagnosed by nding positive
stained blood smears for infected erythrocytes. During this period,
there is a signicant decrease in hematocrit due to anemia in the
rst few days. In persistent infection, bacteria may not be detected
[36]. The persistence of the infection subclinically in the herd may
cause the infection to be overlooked, and therefore, anaplasmosis
control programs cannot be designed [35]. A. marginale infections are
endemic in Türkiye, and most animals are reservoirs for this infection
[37]. A. marginale does not cause human disease [33].
Other Anaplasma species that can cause anaplasmosis in
cattle are A. centrale, which causes a mild disease; A. bovis and A.
phagocytophilum, also known as tick–borne fever. A. phagocytophilum
is zoonotic. Congenital transmission of this agent to cattle has been
reported. The severity of symptoms that occur after a latent period,
such as fever, anemia, shortness of breath, loss of appetite, loss
of productivity, abortion or stillbirth, are related to factors like the
animal’s immune status and co–infections [34]. In recent years,
research on vector–borne diseases has been ongoing in various
parts of the world. In a study conducted in Kyrgyzstan, the molecular
prevalence of Anaplasma spp. was determined to be 1.7%, and
the presence of A. centrale, A. phagocytophilum like–1 and human
pathogenic new genotype A. capra agents was detected through
sequence studies of the 16S rRNA gene in cattle in this region [38].
In another study conducted on cattle in Thailand, 20.8% of the
blood samples were found positive for Anaplasma spp. by molecular
methods, and of these 20.8%, were determined to be A. marginale
and 3.2% for A. platys. A. bovis agent was not detected [39]. In a study
conducted in China, 3.2% of 493 blood samples taken from dairy cattle
were found positive for Anaplasma spp. [40]. A study was conducted
in the northern region of Türkiye’s Black Sea to examine cattle blood
samples with molecular methods for Anaplasma agents. The results
showed that A. phagocytophilum was present in 30.8% of the samples,
A. marginale in 18.8%, A. centrale in 18%, and A. bovis in only 0.7% of
the samples [41]. In another, more comprehensive molecular–based
study conducted with blood samples taken from cattle in the same
region of Türkiye, the presence of A. marginale, A. centrale, and A.
phagocytophilum agents was found at rates of 2.8%, 1.0%, and 1.0%,
respectively [42]. In a recent study covering 16 provinces, mainly in
the Central Anatolia and Southeastern Anatolia Regions of Türkiye, A.
marginale was detected in 10.5% of the samples, A. phagocytophilum
in 13.8%, A. bovis in 0.5%, and Anaplasma spp. in 2.9% [1]. In another
study conducted in Malatya, eastern Türkiye, it was observed that the
most common species in cattle was A. marginale (32.5%), followed by
A. centrale (5.5%) and other Anaplasma agents [43]. Recent studies
conducted in Türkiye show that the molecular prevalence of this
pathogen in cattle is between 0% and 30.8% [1].
Consistent with these studies, in current study, the molecular
prevalence of A. phagocytophilum agents in the Mugla region was
determined to be 15%. Although there are studies on Anaplasma and
other tick–borne diseases in small ruminants and pet animals in the
Aegean Region provinces where this study was conducted [44, 45,
46, 47] studies on cattle are limited in our region. No research on this
subject has been found in Mugla. In a study conducted in Aydın region,
a province close to our region, it was found that A. phagocytophilum
species were found at a higher rate than A. marginale and A.
Centrale; A. marginale infections peaked in March and September,
and A. centrale infection started in March. It was determined that it
continued to increase until September and then decreased. The A.
phagocytophilum agent was detected regularly without uctuation.
Consistent with this study, the highest molecular prevalence in the
Mugla region was seen in A. phagocytophilum (15%). A. marginale and
A. centrale agents were not detected. It has been stated that this
situation may be due to the presence of the agents in the blood of
animals at varying levels depending on the months in the region or
due to the low prevalence of these agents in the region [48]. Since
current study was carried out on samples taken between June and
September, it was thought that the absence of A. marginale and A.
centrale agents when the previous study ndings were examined
may be due to the lower prevalence of the relevant agents in the
summer months in the region. To have complete information about
the prevalence of diseases, it is necessary to evaluate the results by
sampling at regular intervals in the region over a broader period of
time and to conduct further research on the subject.
In the literature, A. ovis is stated as the main agent responsible
for the anaplasmosis of sheep and goats. Although the agent is not
associated with cattle [36], in current study, it was found to be a
mixed infection agent with A. phagocytophilum in 6 different samples
and as a single agent in 2 different samples more, than one agent can
commonly be detected in animals infested by more than one tick.
This situation may cause the severity of the disease to increase [49].
Similar results in the world and our country conrm the existence of
anaplasmosis due to A. ovis bacteria in cattle [40, 42]. In Türkiye, in the
Black Sea region, Aktas et al. (2011), in the 16S rRNA sequence analysis,
it was found that the sequence results of 3 samples from bovines were
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34456
5 of 7
100% similar to A. ovis, the causative agent of sheep anaplasmosis
[42]. A. bovis, transmitted by Amblyomma and Rhipicephalus tick
species, causes subclinical disease in cattle [10]. Recent studies
conducted in Türkiye and around the world have revealed the presence
of A. bovis in cattle [1, 40, 50], but this agent was not found in cattle
in the study conducted in the Aydın region in our country. However, a
low rate of A. bovis agent carriers was determined from ticks collected
from animals [48]. A. bovis agent was detected at a low rate (1%) in
the blood samples examined in current study, which suggests that
it is parallel to this picture in the nearby region.
Babesia spp. and Theileria spp. were not detected in the blood
samples collected within the scope of this study. In Türkiye, similar
cases where the agents in question are negative have been reported in
different studies [51, 52]. In addition, tick–borne anaplasmosis agents,
unlike Babesia and Theileria agents, can be transmitted biologically by
ticks as well as mechanically by some blood–sucking ies [53]. This
may explain why blood samples are positive for anaplasmosis but
negative for Babesia spp. and Theileria spp. Tick samples collected
from cattle in Türkiye have been found to contain Ehrlichia spp. and
Rickettsia spp. according to a study by Ji et al. (2022) [54]. There
is insucient research on Rickettsial disease in cattle in Turkey. In
a recent study, Ceylan et al. (2024) reported E. minasensis for the
rst time with a prevalence rate of 0.5% (55). 51 tick species have
been identied in Türkiye due to suitable climatic conditions and
abundant wild and domestic animals [54]. Seasonal variation of ticks
depends on the breed. Rhipicephalus and Hyalomma species are found
in spring, summer and autumn, while Dermacentor, Hemaphysalis,
Ixodes and Ornithodoros species are found in autumn, winter and
spring. Dermacentor, Haemaphysalis, Hyalomma, Ixodes, Rhipicephalus
(Boophilus) tick genera are commonly found throughout Türkiye [36,
54]. In a study conducted in the west of Türkiye and in the region
where the samples were collected in current study, tick genera
and species were dened according to months, and in the period
between June and September, when the samples were collected in
current study, it was determined that Hyalomma species, especially H.
marginatum, were present at a higher rate, and Rhipicephalus genus
ticks were found at a lower rate [56]. The occurrence and severity of
these tick–borne diseases are associated with many factors, including
seasonal or articially induced uctuations in the tick population
and the resulting immune status of affected cattle [57]. In a study
conducted in northern Türkiye [58], the region was grouped and
examined according to climate characteristics and different carrier
rates were determined in the same tick species. Different studies
report tick–borne disease cases with different prevalences. This may
be due to the change in vector population due to changing climate
conditions or the agent carrier feature of tick species. Therefore,
considering global climate change, it is important to prepare up–to–
date possible disease maps at the regional level by conducting more
research on vector–borne diseases, vector diversity, seasonal vector
distributions, and the agent carrier rates of these vectors.
CONCLUSION
These infections, both bacterial and protozoan, have been
increasing in recent years, and global climate change and animal
movements have a signicant impact on the spread of such infections
in farm animals. Studies have shown that these infections, which
have been found to cause signicant economic losses in cattle,
are accompanied by fever, hemolytic anemia, abortion in pregnant
animals and, in some cases, death. Mugla province, located in the
west of Türkiye, has a subtropical dry summer climate; therefore, the
probability of infections transmitted through arthropods is high. Since
the agents are transmitted through ticks, it is important to conduct
more studies on vector–borne diseases, create maps of vector ticks
in the region, and determine and evaluate tick carriers and existing
disease maps in cattle. The data obtained is thought to be useful in
creating regional and national vector–borne disease maps.
Funding
This paper has been granted by Mugla Sıtkı Koçman University
Research Support and Funding Oce through Project Grant Number:
(23/156/02/3/4).
Ethics approval
This research project was approved by the Animal Experiments
Local Ethic Committee of Mugla Sitki Kocman University under
number E–40051172–100–429028.
Conict of interests
No conicts of interest for all authors are declared.
BIBLIOGRAPHIC REFERENCES
[1] Ceylan O, Ma Z, Ceylan C, Culha MH, Galon EM, Ji S, Li H, Zafar I,
Mohanta UK, Xuan X, Sevinc F. Wide bovine tick–borne pathogen
spectrum: Predominancy of Theileria annulata and the rst
molecular detection of Ehrlichia minasensis in Turkey. Vet. Res.
Commun. [Internet]. 2024; 48(2):1037–1059. doi: https://doi.
org/g5rbvm
[2] Xu J, Gu XL, Jiang ZZ, Cao XQ, Wang R, Peng QM, Li ZM, Zhang
L, Zhou CM, Qin XR, Yu XJ. Pathogenic Rickettsia, Anaplasma,
and Ehrlichia in Rhipicephalus microplus ticks collected from
cattle and laboratory hatched tick larvae. PLOS Negl. Trop. Dis.
[Internet]. 2023; 17(8):e0011546. doi: https://doi.org/g5rbvr
[3] Diop A, El Karkouri K, Raoult D, Fournier PE. Genome sequence–
based criteria for demarcation and denition of species in the
genus Rickettsia. Int. J. Syst. Evol. Microbiol. [Internet]. 2020;
70(3):1738–1750. doi: https://doi.org/g5rbvv
[4] Lu M, Tian J, Wang W, Zhao H, Jiang H, Han J, Guo W, Li K. High
diversity of Rickettsia spp., Anaplasma spp., and Ehrlichia spp. in
ticks from Yunnan Province, Southwest China. Front. Microbiol.
[Internet]. 2022; 13:1008110. doi: https://doi.org/g5rbvw
[5] Osorio M, Miranda J, Gonzalez M, Mattar S. Anaplasma sp.,
Ehrlichia sp., and Rickettsia sp. in ticks: a high risk for public
health in Ibagué, Colombia. Kafkas Univ. Vet. Fak. Derg.
[Internet]. 2018; 24(4):557–562. doi: https://doi.org/g5rbvx
[6] Soosaraei M, Haghi MM, Etemadifar F, Fakhar M, Teshnizi SH,
Asfaram S, Esboei BR. Status of Anaplasma spp. infection in
domestic ruminants from Iran: A systematic review with meta–
analysis. Parasite Epidemiol. Cont. [Internet]. 2020; 11:e00173.
doi: https://doi.org/g5rbvz
[7] Vidotto MC, Kano SF, Gregori F, Headley SA, Vidotto O. Phylogenetic
analysis of Anaplasma marginale strains from Paraná State, Brazil,
using the msp1α and msp4 genes. J. Vet. Med. Ser. B. [Internet].
2006; 53(9):404–411. doi: https://doi.org/bnfvnf
Vector-borne diseases in cattle / Yalçın et al. _______________________________________________________________________________________
6 of 7
[8] Dahmani M, Davoust B, Benterki MS, Fenollar F, Raoult D,
Mediannikov O. Development of a new PCR–based assay to
detect Anaplasmataceae and the rst report of Anaplasma
phagocytophilum and Anaplasma platys in cattle from Algeria.
Comp. Immunol. Microbiol. Infect. Dis. [Internet]. 2015; 39:39–45.
doi: https://doi.org/f68jg5
[9] Park J, Han DG, Ryu JH, Chae JB, Chae JS, Yu DH, Park BK, Kim
HC, Choi KS. Molecular detection of Anaplasma bovis in Holstein
cattle in the Republic of Korea. Acta Vet. Scand. [Internet]. 2018;
60:1–5. doi: https://doi.org/g5rbv4
[10] Peter SG, Aboge GO, Kariuki HW, Kanduma EG, Gakuya DW,
Maingi N, Mulei CM, Mainga AO. Molecular prevalence of emerging
Anaplasma and Ehrlichia pathogens in apparently healthy dairy
cattle in peri–urban Nairobi, Kenya. BMC Vet. Res. [Internet].
2020; 16:364. doi: https://doi.org/g5rbv5
[11] Dumler JS. Anaplasma and Ehrlichia Infection. Ann. N.Y. Acad.
Sci. [Internet]. 2005; 1063(1):361–373. doi: https://doi.org/c6vrnc
[12] Basit MA, Ijaz M, Khan JA, Ashraf K, Abbas RZ. Molecular evidence
and hematological profile of bovines naturally ınfected with
ehrlichiosis in southern Punjab, Pakistan. Acta Parasit. [Internet].
2022; 67(1):72–78. doi: https://doi.org/g5rbv9
[13] Peter SG. Zoonotic Anaplasma and Ehrlichia infections and their
potential reservoirs: A review. Int. J. Vet. Sci. [Internet]. 2020 [cited
25 Apr. 2024]; 9(1):1–9. Available in: https://goo.su/BcWQwM
[14] Adjadj NR, Cargnel M, Ribbens S, Quinet C, Malandrin L, Mignon
B, Mori M. Prevalence of Anaplasma phagocytophilum, Borrelia
burgdorferi sensu lato, Rickettsia spp. and Babesia spp. in cattle
serum and questing ticks from Belgium. Ticks Tick–borne Dis.
[Internet]. 2023; 14(4):102146. doi: https://doi.org/gr4nd6
[15] Barradas PF, Mesquita JR, Ferreira P, Gärtner F, Carvalho M, Inácio
E, Chivinda E, Katimba A, Amorim I. Molecular identication and
characterization of Rickettsia spp. and other tick–borne pathogens
in cattle and their ticks from Huambo, Angola. Ticks Tick–borne
Dis. [Internet]. 2021; 12(1):101583. doi: https://doi.org/g5rbwb
[16] Kim HK. Rickettsia–host–tick Interactions: Knowledge advances
and gaps. Infect. Immun. [Internet]. 2022; 90:e00621–21. doi:
https://doi.org/g5rbwc
[17] Merino O, Almazan C, Canales M, Villar M, Moreno–Cid JA,
Galindo RC, de la Fuente J. Targeting the tick protective antigen
subolesin reduces vector infestations and pathogen infection by
Anaplasma marginale and Babesia bigemina. Vaccine. [Internet].
2011; 29(47):8575–8579. doi: https://doi.org/dvg4xq
[18] Gosh S, Azhahianambi P, Yadav MP. Upcoming and future
strategies of tick control: a review. J. Vector Borne Dis. [Internet]
2007 [cited 24 Apr. 2024]; 44(2):79–89. PMID: 17722860. Available
in: https://goo.su/rOI52
[19] Homer MJ, Aguilar–Deln I, Telford III SR, Krause PJ, Persing DH.
Babesiosis. Clin. Microbiol. Rev. [Internet]. 2000; 13(3):451–469.
doi: https://doi.org/gqjng2
[20] Schnittger L, Rodriguez AE, Florin–Christensen M, Morrison DA.
Babesia: a world emerging. Infect. Genet. Evol. [Internet]. 2012;
12(8):1788–1809. doi: https://doi.org/f22qns
[21] Altay K, Aydin MF, Dumanli N, Aktas M. Molecular detection of
Theileria and Babesia infections in cattle. Vet Parasit. [Internet].
2008; 158(4):295–301. doi: https://doi.org/bftwc8
[22] Inci A, Çakmak A, Karaer Z, Dinçer S, Sayin F, Iça A. Kayseri
yöresinde sığırlarda babesiosis in seroprevalansı [Seroprevalence
of bovine babesiosis around Kayseri]. Turk. J. Vet. Anim. Sci.
[Internet]. 2002 [cited 29 Apr. 2024]; 26(6):1345–1350. Turkish.
Available in: https://goo.su/RW3H
[23] Kar S, Güven E, Karaer Z. Ankara’da Şubat ayında Babesiosis
olgusu [A Babesiosis Case in February in Ankara]. Turkiye
Parazitol. Derg. [Internet]. 2008 [cited 05 May 2024]; 32(4):379–
381. Turkish. Available in: https://goo.su/6uORBzF
[24] Bishop R, Musoke A, Morzaria S, Gardner M, Nene V. Theileria:
Intracellular protozoan parasites of wild and domestic ruminants
transmitted by ixodid ticks. Parasitology. [Internet]. 2004;
129(1):271–283. doi: https://doi.org/ck8qks
[25] Levine ND. Veterinary Protozoology. Ames (Iowa, USA): Iowa
State University Press; 1985. Chapter 9, Apicomplexa: The
Piroplasms. p. 291–328.
[26] Taylor MA, Coop RL, Wall RL, editors. Veterinary Parasitology. 4
th
ed.
Hoboken (New Jersey, USA): John Wiley & Sons, Inc; 2015. 1032p.
[27] Bell–Sakyi L, Palomar AM, Bradford EL, Shkap V. Propagation of
the Israeli vaccine strain of Anaplasma centrale in tick cell lines.
Vet. Microbiol. [Internet]. 2015; 179(3–4):270–276. doi: https://
doi.org/f7p2vg
[28] Pérez Pérez JC, Montoya Ruiz C, Arroyave Sierra E, Paternina LE,
Rodas JD. Design and analytical validation of a duplex PCR for
Ehrlichia and Rickettsia detection in ticks. Rev. Colomb. Cienc.
Pec. [Internet]. 2018; 31(4):285–294. doi: https://doi.org/g5rbwj
[29] Peng Y, Zhao S, Wang K, Song J, Yan Y, Zhou Y, Shi K, Jian F,
Wang R, Zhang L, Ning C. A multiplex PCR detection assay for
the identication of clinically relevant Anaplasma species in
eld blood samples. Front Microbiol. [Internet]. 2020; 11:606.
doi: https://doi.org/g5rbwm
[30] Gubbels JM, De Vos AP, Van der Weide M, Viseras J, Schouls LM, De
Vries E, Jongejan F. Simultaneous detection of bovine Theileria and
Babesia species by reverse line blot hybridization. J. Clin. Microbiol.
[Internet]. 1999; 37(6):1782–1789. doi: https://doi.org/gg88dt
[31] Shrivastava P, Dehuri M, Mohanty B, Mishra C, Venkatesh KM,
Biswal SS. Molecular characterization and prevalence of bovine
hemoprotozoan and rickettsial organism from Bhubaneswar,
Eastern India. Anim. Biotechnol. [Internet]. 2023; 34(7):2917–
2927. doi: https://doi.org/g5rbwn
[32] Kaur R, Yadav A, Raqi SI, Godara R, Sudan V, Chakraborty
D, Katoch R. Epidemiology, haematology and molecular
characterization of haemoprotozoon and rickettsial organisms
causing infections in cattle of Jammu region, North India. BMC
Vet. Res. [Internet]. 2021; 17:219. doi: https://doi.org/g5rbwq
[33] Aubry P, Geale DW. A review of bovine anaplasmosis. Transbound.
Emerg. Dis. [Internet]. 2011; 58(1):1–30. doi: https://doi.org/bpsfgv
[34] Parvizi O, El–Adawy H, Melzer F, Roesler U, Neubauer H, Mertens–
Scholz K. Seroprevalence and molecular detection of bovine
anaplasmosis in Egypt. Pathogens [Internet]. 2020; 9(1):64.
doi: https://doi.org/g5rbwr
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34456
7 of 7
[35] Spare MR, Hanzlicek GA, Wootten KL, Anderson GA, Thomson
DU, Sanderson MW, Ganta RR, Reif KE, Raghavan RK. Bovine
anaplasmosis herd prevalence and management practices as
risk–factors associated with herd disease status. Vet. Parasitol.
[Internet]. 2020; 277:100021. doi: https://doi.org/g5rbws
[36] Ceylan O, Xuan X, Sevinc F. Primary tick–borne protozoan and
Rickettsial infections of animals in Turkey. Pathogens [Internet].
2021; 10(2):231. doi: https://doi.org/g5rbwt
[37] Sevinç F, Xuan X. Major tick–borne parasitic diseases of animals:
A frame of references in Turkey. Eurasian J. Vet. Sci. [Internet].
2015; 31(3):132–142. doi: https://doi.org/g5rbww
[38] Altay K, Erol U, Sahin OF, Aytmirzakizi A. First molecular detection
of Anaplasma species in cattle from Kyrgyzstan; molecular
identication of human pathogenic novel genotype Anaplasma
capra and Anaplasma phagocytophilum related strain. Ticks Tick–
borne Dis. [Internet]. 2022; 13(1):101861. doi: https://doi.org/g5rbwx
[39] Seerintra T, Saraphol B, Thanchomnang T, Piratae S. Molecular
prevalence of Anaplasma spp. in cattle and assessment of
associated risk factors in Northeast Thailand. Vet World.
[Internet]. 2023; 16(8):1702–1707. doi: https://doi.org/g5rbw2
[40] Yan Y, Jiang Y, Tao D, Zhao A, Qi M, Ning C. Molecular detection
of Anaplasma spp. in dairy cattle in southern Xinjiang, China.
Vet. Parasitol. Reg. Stud. Reports [Internet]. 2020; 20:100406.
doi: https://doi.org/g5rbw5
[41] Aktas M, Ozübek S. Bovine anaplasmosis in Turkey: First laboratory
conrmed clinical cases caused by Anaplasma phagocytophilum.
Vet. Microbiol. [Internet]. 2015; 178(3–4):246–251. doi: https://doi.
org/f7hcbg
[42] Aktas M, Altay K, Dumanli N. Molecular detection and
identication of Anaplasma and Ehrlichia species in cattle from
Turkey. Ticks Tick–borne Dis. [Internet]. 2011; 2(1):62–65. doi:
https://doi.org/fkrb5g
[43] Aktas M, Çolak S. Molecular detection and phylogeny of
Anaplasma spp. in cattle reveals the presence of novel strains
closely related to A. phagocytophilum in Turkey. Ticks Tick–borne
Dis. [Internet]. 2021; 12(1):101604. doi: https://doi.org/g5rbw8
[44] Bilgic HB, Bakırcı S, Kose O, Unlu AH, Hacılarlıoglu S, Eren H,
Weir W, Karagenc, T. Prevalence of tick–borne haemoparasites
in small ruminants in Turkey and diagnostic sensitivity of single–
PCR and RLB. Parasit. Vectors. [Internet]. 2017; 10:211. doi:
https://doi.org/g5rbw9
[45] Ceylan O, Uslu A, Ozturk O, Sevinc F. Serological investigation
of some vector–borne parasitic and rickettsial agents in dogs in
the western part of Turkey. Pak. Vet. J. [Internet]. 2021 [cited 25
Apr. 2024]; 41(3):386–392. Available in: https://goo.su/prRgxq
[46] Haydardedeoğlu AE, Büyükleblebici O, Aksoy NH, Karaşahin T.
Aksaray Malaklısı Çoban Köpeklerinde Ehrlichia Canis, Anaplasma
Phagocytophilum, Borrelia Burgdorferi, Dirofilara immitis
Enfeksiyonlarının Anlık Dağılımının Belirlenerek Hematolojik
Bulguların Araştırılması [Investigation of hematological ndings
by determining the spatial distribution of infections of Ehrlichia
canis, Anaplasma phagocytophilum, Borrelia burgdorferi, Dirolaria
immitis in Aksaray Malakli Dogs]. Harran Üniv. Vet. Fak. Derg.
[Internet]. 2019; 8(1):38–43. Turkish. doi: https://doi.org/g5rbxc
[47] Ural K, Gultekin M, Atasoy A, Ulutas B. Spatial distribution of
vector borne disease agents in dogs in Aegean region, Turkey.
Revista MVZ Córdoba. [Internet]. 2014; 19(2):4086–4098. doi:
https://doi.org/g5rbxf
[48] Hoşgör M, Bilgiç HB, Bakırcı S, Ünlü AH, Karagenç T, Eren H.
Detection of Anaplasma/Ehrlichia species of cattle and ticks in
Aydın region. Turk. Parazitol. Derg. [Internet]. 2015; 39(4):291–
298. doi: https://doi.org/g4ntd3
[49] Mohammadian B, Noaman V, Emami SJ. Molecular survey on
prevalence and risk factors of Anaplasma spp. infection in cattle
and sheep in West of Iran. Trop. Anim. Health Prod. [Internet].
2021; 53(2):266. doi: https://doi.org/g5rbxj
[50] Aktas M, Ozubek S. Molecular and parasitological survey of bovine
piroplasms in the Black Sea region, ıncluding the first report of
babesiosis associated with Babesia divergens in Turkey. J. Med.
Entomol. [Internet]. 2015; 52(6):1344–1350. doi: https://doi.org/f72c9m
[51] Altay K, Atas AD, Ograk YZ, Ozkan E. Survey of Theileria, Babesia
and Anaplasma infections of cattle and ticks from Sivas region of
Turkey. Erciyes Univ. Vet. Fak. Derg. [Internet]. 2020; 17(1):32–38.
doi: https://doi.org/g5rbxm
[52] Yavuz A, Inci A, Düzlü Ö, Bişkin Z, Yildirim A. Babesia bovis’in msa–2c
Geninin Moleküler Karakterizasyonu [Molecular characterization
of babesia bovis msa–2c gene]. Turkiye Parazitol. Derg. [Internet].
2011; 35(3):140–144. Turkish. doi: https://doi.org/bv5cjj
[53] Woldehiwet Z. The natural history of Anaplasma phagocytophilum.
Vet. Parasit. [Internet]. 2010; 167(2–4):108–122. doi: https://doi.
org/fqcxwm
[54] Ji S, Ceylan O, Ma Z, Galon EM, Zafar I, Li H, Hasegawa Y, Sevinc
M, Masatani T, Iguchi A, Kawase O, Umemiya–Shirafuji R, Asada
M, Sevinc F, Xuan X. Protozoan and rickettsial pathogens in
ticks collected from infested cattle from Turkey. Pathogens
[Internet]. 2022; 11(5):500. doi: https://doi.org/g5rbxq
[55] Ceylan O, Ma Z, Ceylan C, Culha MH, Galon EM, Ji S, Li H, Zafar I,
Mohanta UK, Xuan X, Sevinc F. Wide bovine tick–borne pathogen
spectrum: Predominancy of Theileria annulata and the rst
molecular detection of Ehrlichia minasensis in Turkey. Vet. Res.
Commun. [Internet]. 2024; 48(2):1037–1059. doi: https://doi.
org/g5rbvm
[56] Bakirci S, Sarali H, Aydin L, Eren H, Karagenc T. Distribution and
seasonal activity of tick species on cattle in the West Aegean
region of Turkey. Exp. Appl. Acarol. [Internet]. 2012; 56(2):165–
178. doi: https://doi.org/crz99j
[57] Henker LC, Lorenzett MP, Fagundes–Moreira R, Dalto AGC,
Sonne L, Driemeier D, Soares JF, Pavarini SP. Bovine abortion,
stillbirth and neonatal death associated with Babesia bovis and
Anaplasma sp. infections in southern Brazil. Ticks Tick–borne
Dis. [Internet]. 2020; 11(4):101443. doi: https://doi.org/jzcz
[58] Aktas M, Altay K, Ozubek S, Dumanli N. A survey of ixodid ticks
feeding on cattle and prevalence of tick–borne pathogens in
the Black Sea region of Turkey. Vet. Parasitol. [Internet]. 2012;
187(3–4):567–571. doi: https://doi.org/f32t7p
