Invest Clin 63(1): 92 - 99, 2022 https://doi.org/10.54817/IC.v63n1a08

Corresponding author: Flor H Pujol, Laboratorio de Virología Molecular, IVIC, CMBC, Caracas, Venezuela.

E-mail: fhpujol@gmail.com

Detection of the Omicron variant of SARS-

CoV-2 by restriction analysis targeting

the mutations K417N and N440K

of the spike protein.

Rossana C Jaspe1, José Luis Zambrano2, Mariana Hidalgo3, Yoneira Sulbarán1,

Carmen L Loureiro1, Zoila C Moros2, Domingo J Garzaro1, Ferdinando Liprandi2,

Héctor R Rangel1 and Flor H Pujol1

1Laboratorio de Virología Molecular, Centro de Microbiología y Biología Celular,

Instituto Venezolano de Investigaciones Científicas, Caracas, Venezuela.

2Laboratorio de Biología de Virus, Centro de Microbiología y Biología Celular, Instituto

Venezolano de Investigaciones Científicas, Caracas, Venezuela.

3Laboratorio de Inmunoparasitología, Centro de Microbiología y Biología Celular,

Instituto Venezolano de Investigaciones Científicas, Caracas, Venezuela.

Key words: COVID-19; SARS-CoV-2; Omicron Variant of Concern; RFLP; rapid screening.

Abstract. By the end of 2021, the Omicron variant of concern (VOC)

emerges in South Africa. This variant caused immediate concern, due to the

explosive increase in cases associated with it and the large number of muta-

tions it exhibits. In this study, the restriction sites that allow detecting the

mutations K417N and N440K in the Spike gene are described. This analysis al-

lows us to propose a rapid method for the identification of cases infected with

the Omicron variant. We show that the proposed methodology can contribute

to provide more information on the prevalence and rapid detection of cases of

this new VOC.

Rapid detection of SARS-CoV-2 Omicron variant 93

Vol. 63(1): 92 - 99, 2022

Detección de la Variante Ómicron del SARS-CoV-2 por análisis

de restricción de dos mutaciones de la proteína de la espiga

Invest Clin 2022; 63 (1): 92 – 99

Palabras clave: COVID-19; SARS-CoV-2; Variante Omicron; RFLP; detección rápida.

Resumen. Para finales de 2021 surge la variante de preocupación (VOC

por sus siglas en inglés) Ómicron en Sudáfrica. Esta variante causó de forma

inmediata preocupación, debido al aumento explosivo de casos asociados a ella

y al gran número de mutaciones que exhibe. En este estudio, se describen los

sitios de restricción que permiten detectar dos de estas mutaciones en el gen

de la espiga, las mutaciones K417N y N440K. Este análisis permite proponer

un método rápido para la identificación de casos infectados con la variante

Ómicron. Mostramos que la metodología propuesta puede contribuir a propor-

cionar más información sobre la prevalencia y a detectar rápidamente los casos

de esta nueva VOC.

Received: 29-01-2022 Accepted: 05-02-2022

INTRODUCTION

The COVID-19 pandemic is caused by

an emerging coronavirus, SARS-CoV-2, and

has caused more than 360 million cases

and more than 5 million deaths worldwide.

This virus belongs to the family Coronaviri-

dae. The tremendous number of replication

events that this virus has experienced, in ad-

dition to an elevated frequency of recombi-

nation, and the probable action of host de-

aminases on the viral genome 1, has allowed

the emergence of many mutations in the vi-

ral genome 2.

Different variants (lineages of viruses

sharing particular types of mutations) have

emerged since the end of 2020. Some of

these variants have been defined as of inter-

est (VOI) or concern (VOC) by WHO, asso-

ciated with more transmissibility, or partial

resistance to protective immunity, among

other characteristics. The variants for which

at least one of these characteristics has been

confirmed, are named VOC 3-7. There are at

present five VOCs: Alpha, which emerged

in the UK, Beta in South Africa, Gamma in

Brazil, Delta in India, and Omicron in South

Africa. Genomic surveillance is recommend-

ed for monitoring the introduction of SARS-

CoV-2 variants of concern (VOCs) in each

country 6, 7.

Since the middle of 2021, the Delta

VOC (lineage B.1.617.2) was predominating

in many countries and replacing the other

circulating variants. However, at the end

of November 2021, Omicron VOC (lineage

B.1.1.529) was identified in South Africa 8.

This variant was classified as VOC in a re-

cord time because of the explosive increase

of cases in South Africa, and the great num-

ber of mutations exhibited by this new lin-

eage. Since then, up to January 15, 2022,

the VOC Omicron has been detected in at

least 119 countries (Complete genome se-

quences submitted in GISAID: https://www.

gisaid.org/hcov19-variants/) and is present-

ly replacing Delta worldwide 9.

Omicron VOC exhibits more than 50

mutations in its complete genome, com-

94 Jaspe et al.

Investigación Clínica 63(1): 2022

pared to the ancestral Wuhan strain. More

than 30 of these mutations are located in

the spike protein 8, 10. Rapid detection of this

variant is particularly important, due to the

explosive nature of its transmission. The aim

of this study was to evaluate a method for

rapid detection of this mutation by restric-

tion enzyme analysis, taking advantage of

two mutations present in this VOC: K417N

and N440K.

MATERIALS AND METHODS

Sequences available at GISAID on Jan-

uary 15, 2022, were analyzed for the pres-

ence of two mutations of the Omicron VOC:

K417N and N440K. at https://www.gisaid.

org. The number of sequences belonging to

the Delta VOC among the ones harboring

this mutation was also estimated.

This study was approved by the Bioethi-

cal Committee of IVIC. A restriction enzyme

analysis was developed to detect the pres-

ence of two mutations: K417N and N440K.

RNA from clinical samples positive by qRT-

PCR (classified upon sequencing as Delta or

Omicron) were amplified with primers 75L

(AGAGTCCAACCAACAGAATCTATTGT) and

76.8R (GTTGCTGGTGCATGTAGAAGTTC)

to generate an amplicon of 614 nt, with the

PCR conditions previously described 11, with

denaturation times of 94°C/30 sec. Six µL

of the amplicon were digested with one unit

of HindIII or SspI for one hour at 37°C and

then loaded in a 3% agarose gel electropho-

resis for band visualization with Ethidium

bromide. Restriction results were compared

with the sequence obtained by sending PCR

purified fragments to the Macrogen Se-

quencing Service (Macrogen, Korea).

RESULTS

Sequences available at GISAID, belong-

ing to the Delta or Omicron variant lineages,

were analyzed for the presence of K417N and

N440K. A total of 7,136,478 were available

at GISAID on January 15, 2022. Only se-

quences of the complete genome and with

high coverage were analyzed. As can be seen

in Table 1, while 73% of the sequences avail-

able for the Delta variant meet both criteria,

only 2% of the Omicron VOC meet them. The

presence of K417N or N440K was near 90%

in the Omicron VOC lineages, compared to

less than 1% in the Delta VOC ones. Accord-

ing to this prevalence data, the detection of

one of these two mutations could result in

an assay with 94.4% sensitivity and 99.8%

specificity.

The analysis of the restriction sites pres-

ents in the 614 nt amplicon of the spike gene

Table 1

Number of sequences available at GISAID of Delta or Omicron VOC harboring

the mutations K417N and N440K.

Number of sequences (%)* Delta

(B.1.617.2)

Omicron

(B.1.1529)

Total sequences 4,061,464 364,148

Sequences of complete genome with high

coverage (SCH)

2,954,586 (73%)

5,995 (2%)

SCH with K417N 4,831 (0.2%) 5,415 (90%)

SCH with N440K 99 (0.002%) 5,263 (88%)

SCH with both mutations 0** 5,016 (84%)

SCH with any of the mutations 5,830 (0.2%) 5,662 (94.4%)

*Sequences available at GISAID in January 15, 2022. **12 sequences were available with both mutations among

the 4,061,464 total sequences of the Delta variant.

Rapid detection of SARS-CoV-2 Omicron variant 95

Vol. 63(1): 92 - 99, 2022

of SARS-CoV-2 showed the presence of a re-

striction site in the nucleotides correspond-

ing to the K417N and N440K mutations. Fig.

1 shows the expected restriction pattern of

samples and isolates harboring mutations

K417N and N440K, by using two restriction

enzymes: SspI for K417N and HindIII for

N440K: the SspI enzyme has an additional

restriction site in the respective mutated

sample and HindIII an unique restriction site

in the mutation N440K. Fig. 1C shows the

digestion of the PCR-amplified product with

the two enzymes of two samples with the two

mutations (Omicron variant) and two sam-

ples without the mutations (Gamma or Delta

variant). A total of 28 samples were analyzed

for their restriction pattern with these two

enzymes, and compared for the presence or

not of the mutations K417N and N440K in

their sequence. A 100% concordance was ob-

served in the detection of the two mutations

between the two methods (Table 2). In addi-

tion, the sequence of the complete genome

was available for three of the samples ana-

lyzed, and again a perfect concordance was

found with the variant assigned by restric-

tion analysis of the sequencing of the small

genomic fragment: two Omicron VCs (GI-

SAID accession numbers EPI_ISL_8063574

and EPI_ISL_8063663) and one Delta VOC

(EPI_ISL_8804532). All the Omicron VOCs

analyzed in this study harbored both muta-

tions K417N and N440K.

DISCUSSION

For evaluating the projected sensitivity

of restriction analysis using these two muta-

tions as an indicator of Omicron presence,

sequences available at GISAID were evaluat-

ed for the presence of the mutations K417N

and N440K. The prevalence between Omi-

cron and Delta VOCs was compared, since

the Delta VOC was circulating and predomi-

nating in almost every part of the world just

before the Omicron VOC rise in cases.

In addition to the huge number of

mutations and rise in cases in each coun-

try, where this variant began to circulate,

another peculiarity of the Omicron VOC is

the variability in the number of mutations

displayed by each isolate, that is, not all the

isolates harbor all the mutations described

for this variant. Indeed, the authors found a

prevalence of less than 50% for the two mu-

tations analyzed in this study, although they

also recognized that the prevalence reported

in their study might be higher for some of

these mutations 8. The rush in submitting se-

quences for the Omicron variant, shown by

the huge predominance of complete genome

sequences with low coverage (98%, com-

pared to only 27% for Delta VOC, see Table

1), is an important factor that may hamper

the real prevalence of each mutation in the

Omicron VOC genomes.

According to the analysis performed

on the sequences submitted to GISAID,

the predicted sensitivity of the proposed

restriction analysis, based on the detec-

tion of at least one of the K417N or N440K

mutations, should result in a test with at

least 94% sensitivity. Indeed, the sensitiv-

ity could be even higher, considering the

possibility that some of the Omicron VOC

sequences deposited in GISAID may har-

bor non-resolved nucleotides in the sites of

these two mutations. In addition to few Del-

ta VOCs, the Beta VOC harbors the muta-

tion K417N. Thus, the detection of this mu-

tation might not guarantee the presence of

the Omicron VOC. However, the frequency

of Beta VOC has been very low in the last

months. A search in GiSAID resulted in only

six sequences of Beta VOC from December

2021 up to January 2022.

A perfect correlation was found in

this study between the restriction and se-

quence analysis. All the sequences analyzed

harbored the two mutations, in agreement

with the high prevalence of both muta-

tions found in the sequence analyzed in this

study, and providing a predictive value of al-

most 100% of Omicron identification. This

method indeed allowed us to detect the first

Omicron cases in Venezuela (Jaspe, RC, and

96 Jaspe et al.

Investigación Clínica 63(1): 2022

Fig. 1. Restriction analysis of amplicons with K417N and N440K mutations. A. Sequence of the amplified pro-

duct showing the restriction sites which discriminate Wild-type (WT) or mutant (K417N and N440K)

viruses. The use of these two enzymes generates a restriction pattern characteristic for each situation

(WT, K417N, and N440K). The restriction sites are underlined. The numbers in the alignment indi-

cate the bp position in the PCR-amplified product. Nucleotides 79-81 code for the amino acid K417

(CTG) or N417 (CGG). Nucleotides 79-81 code for the amino acid N440 (CTG) or K440 (CGG). B.

Expected digestion pattern with HindIII or SspI enzymes. With HindIII digestion, the WT amplicon

generates an undigested product of 614 bp, while N440K mutated amplicon generates 2 bands: one

of 384 pb and one of 250 bp. With SspI digestion, WT amplicon generates two bands: one of 575 pb

and one of 40 bp that is not seen in the gel, while K417N mutated amplicon generates three bands

of 317, 258, and 40 bp that is not seen in the gel. C. Agarose gel electrophoresis of PCR-amplified

products digested with HindIII or SspI. The PCR-amplified products digested with the enzymes were

run with molecular weight markers (100bp DNA Ladder Molecular Weight Marker, Promega): smaller

bands are signaled (100, 200, and 300 bp).

Rapid detection of SARS-CoV-2 Omicron variant 97

Vol. 63(1): 92 - 99, 2022

Pujol, FH, personal communication). Our

group has already developed several restric-

tion analyses for the detection of key mu-

tations present in some VOCs, like E484K

and L452R 12, 13. The method proposed in

this study, together with the previously de-

veloped for other mutations, has been very

useful in our hand for rapid detection of the

variant in particular cases. It is important

to note that complete genome sequencing

is necessary for confirmation of the variant

assignment, but once Omicron VOC is ex-

panding in a particular region, the detec-

tion of these mutations is highly predictive

of its presence.

Due to its explosive reproductive rate,

rapid methods for detection of the Omicron

VOC are warranted. In our hands, the detec-

tion of two of its mutations by restriction

analysis was very useful for the rapid detec-

tion of the Omicron VOC.

Funding

This study was supported by Ministerio

del Poder Popular de Ciencia, Tecnología e

Innovación of Venezuela.

Declaration of conflict of interest

The authors declare no conflict of in-

terest.

Authors’ ORCID numbers

• Rossana C Jaspe (RCJ)

0000-0002-4816-1378

• José Luis Zambrano (JLZ)

0000-0001-9884- 2940

• Mariana Hidalgo (MH)

0000-0002-8307-8254

• Yoneira Sulbaran (YS)

0000-0002-3170-353X

• Carmen L Loureiro (CLL)

0000-0003-3665-1107

• Zoila C Moros (ZCM)

0000-0001-6322-9230

• Domingo J Garzaro (DJG)

0000-0002-9956-5786

• Ferdinando Liprandi (FL)

0000 0001 8084 8252

• Héctor R Rangel (HRR)

0000-0001-5937-9690

• Flor H Pujol (FHP)

0000-0001-6086-6883

Authorship contribution

• RCJ and JLZ contributed equally to

this study.

• Design of the study and writing of

the manuscript: RCJ, JLZ, FL, FHP. Ex-

perimental: RCJ, MH, YS, CLL, ZCM,

DJG, HRR.

• All the authors read and approved

the final version of the manuscript.

Table 2

Concordance between restriction enzyme analysis and sequencing results.

Sequence analysis

Restriction analysis

K417 and N440

(Delta)

N417 and K440

(Omicron) Concordance

K417 and N440 15 0 100%

N417 and K440 0 13

A total of 28 samples were analyzed: 15 Delta VOC (lineage B.1.617.2), without any of the two mutations, and 13

Omicron VOC (lineage B.1.1.529).

98 Jaspe et al.

Investigación Clínica 63(1): 2022

REFERENCES

1. Pujol FH, Zambrano JL, Jaspe R, Loureiro

CL, Vizzi E, Liprandi F, Rangel HR. Bio-

logía y evolución del coronavirus causante

de la COVID-19. Rev Soc Venezol Microbiol

2020; 40:63-70.

2. Phan T. Genetic diversity and evolution

of SARS-CoV-2. Infect Genet Evol 2020;

81:104260. https://doi.org/10.1016/j.mee-

gid.2020.104260.

3. Rotondo JC, Martini F, Maritati M,

Mazziotta C, Di Mauro G, Lanzillot-

ti C, Barp N, Gallerani A, Tognon M,

Contini C. SARS-CoV-2 infection: new

molecular, phylogenetic, and pathogene-

tic insights. Efficacy of current vaccines

and the potential risk of Variants. Viruses

2021; 13:1687. https://doi.org/10.3390/

v13091687

4. World Health Organization. Tracking

SARS-CoV-2 variants. Available from: URL:

https://www.who.int/en/activities/trac-

king-SARS-CoV-2-variants/. [revised on Ja-

nuary 26, 2022].

5. Mistry P, Barmania F, Mellet J, Peta K,

Strydom A, Viljoen IM, James W, Gordon

S, Pepper MS. SARS-CoV-2 variants, vac-

cines, and host immunity. Front Immunol

2022; 12:809244. https://doi.org/10.3389/

fimmu.2021.809244.

6. Alefishat E, Jelinek HF, Mousa M, Tay

GK, Alsafar HS. Immune response to

SARS-CoV-2 variants: A focus on severity,

susceptibility, and preexisting immunity.

J Infect Public Health 2022;15(2):277-

288. https://doi.org/10.1016/j.jiph.2022.

01.007.

7. Thye AY, Law JW, Pusparajah P, Letchu-

manan V, Chan KG, Lee LH. Emerging

SARS-CoV-2 Variants of Concern (VOCs):

an impending global crisis. Biomedicines

2021;9(10):1303. https://doi.org/10.3390/

biomedicines9101303.

8. Viana R, Moyo S, Amoako DG, Tegally H,

Scheepers C, Althaus ChL, Anyaneji UJ,

Bester PhA, Boni MF, Chand M, Choga

WT, Colquhoun R, Davids M, Deforche

K, Doolabh D, du Plessis L, Engelbrecht

S, Everatt J, Giandhari J, Giovanetti M,

Hardie D, Hill V, Hsiao NY, Iranzadeh A,

Ismail A, Joseph Ch, Joseph R, Koopile

L, Kosakovsky Pond SL, Kraemer MUG,

Kuate-Lere L, Laguda-Akingba O, Lese-

tedi-Mafoko O, Lessells RJ, Lockman

Sh, Lucaci AG, Maharaj A, Mahlangu B,

Maponga T, Mahlakwane K, Makatini Z,

Marais G, Maruapula D, Masupu K, Ma-

tshaba M, Mayaphi S, Mbhele N, Mbu-

lawa MB, Mendes A, Mlisana K, Mnguni

A, Mohale Th, Moir M, Moruisi K, Mo-

sepele M, Motsatsi G, Motswaledi MS,

Mphoyakgosi Th, Msomi N, Mwangi PN,

Naidoo Y, Ntuli N, Nyaga M, Olubayo L,

Pillay S, Radibe B, Ramphal Y, Ramphal

U, San JE, Scott L, Shapiro R, Singh L,

Smith-Lawrence P, Stevens W, Strydom

A, Subramoney K, Tebeila N, Tshiabui-

la D, Tsui J, van Wyk S, Weaver S, Wib-

mer CK, Wilkinson E, Wolter N, Zareb-

ski AE, Zuze B, Goedhals D, Preiser W,

Treurnicht F, Venter M, Williamson C,

Pybus OG, Bhiman J, Glass A, Martin

DP, Rambaut A, Gaseitsiwe S, von Got-

tberg A, de Oliveira T. Rapid epidemic

expansion of the SARSCoV-2 Omicron

variant in Southern Africa. Nature 2022

Jan 7. https://doi.org/10.1038/s41586-

022-04 411-y.

9. Health professionals and researchers from

across Europe. Europe must come together

to confront omicron. BMJ. 2022;376:o90.

https://doi.org/10.1136/bmj.o90.

10. Ren SY, Wang WB, Gao RD, Zhou AM.

Omicron variant (B.1.1.529) of SARS-

CoV-2: Mutation, infectivity, transmis-

sion, and vaccine resistance. World J Clin

Cases 2022;10(1):1-11. https://doi.org/

10.12998/wjcc.v10.i1.1.

11. Jaspe RC, Loureiro CL, Sulbaran Y, Mo-

ros ZC, D´Angelo P, Rodríguez L, Zam-

brano JL, Hidalgo M, Vizzi E, Alarcon V,

Aguilar M, Garzaro DJ, CoViMol Group,

Rangel HR, Pujol FH. Introduction and

rapid dissemination of SARS-CoV-2 Gam-

ma Variant of Concern in Venezuela. In-

fect Genet Evol 2021;96:105147. https://

doi.org/10.1016/j.meegid.2021.105147.

12. Jaspe RC, Sulbaran Y, Loureiro CL, D

Angelo P, Rodriguez L, Garzaro D, Ran-

gel HR, Pujol FH. Importance of muta-

tions in amino acid 484 of the Spike pro-

tein of SARS-CoV-2: rapid detection by

restriction enzyme analysis. Invest. Clin.

Rapid detection of SARS-CoV-2 Omicron variant 99

Vol. 63(1): 92 - 99, 2022

2021; 62(Suppl. 2): 16–24. https://doi.

org/10.22209/IC.v62s2a02.

13. Jaspe RC, Sulbaran Y, Hidalgo M, Lou-

reiro CL, Moros ZC, Garzaro D, Rangel

HR, Pujol FH. A simple method for detec-

tion of mutations in amino acid 452 of the

Spike protein of SARS-CoV-2 using restric-

tion enzyme analysis. Invest. Clin 2021;

62(4): 371-377. https://doi.org/10.22209/

IC.v62n4a07.