Invest Clin 63(4): 344 - 352, 2022 https://doi.org/10.54817/IC.v63n4a02
Corresponding author: Qin Jia. Department of Respiration, Shidong Hospital of Yangpu District, No. 999, Shi
Guang Rd, Yangpu District, Shanghai 200438, China. Email: qingjia1_sh@hotmail.com
Apurinic/apyrimidinic endonuclease
1 mRNA level in peripheral blood
neutrophils is associated with asthma.
Zhou Hai and Qin Jia
Department of Respiration, Shidong Hospital of Yangpu District, No. 999, Shi Guang
Rd, Yangpu District, Shanghai 200438, China.
Keywords: apurinic/apyrimidinic endonuclease; asthma: mRNA; inflammation.
Abstract. Apurinic/apyrimidinic endonuclease 1 (APE1) is a multifunc-
tional key protein. Recent studies suggest APE1 is closely associated with in-
flammatory response, but its role in asthma remains unknown. We recruited
116 patients with asthma, including 50 with severe asthma (NSA) and 66 with
non-severe asthma (SA), and 140 controls. Serum APE1 was detected using the
ELISA method. APE1 mRNA in peripheral blood neutrophils and eosinophils
were detected using real-time PCR assays. Compared to healthy controls, we
observed significant elevations of serum APE1 mRNA levels in peripheral neu-
trophils (~1.75 folds increase, p<0.05) and eosinophils (~2.2 folds increase,
p<0.05) in patients with asthma. The peripheral blood neutrophil APE1 mRNA
can distinguish asthmatic patients from healthy controls with the area under
the curve (AUC) 0.893 and a 95% confidence interval (CI) 0.847-0.938 (p <
0.001). Also the APE1 mRNA can identify severe asthma from non-severe asth-
ma (AUC 0.759, 95% CI, 0.674-0.846; p < 0.001). However, The serum APE1
and eosinophil mRNA levels did not correlate with asthma incidence and sever-
ity. Our finding confirms the association between APE1 and asthma and sug-
gests that peripheral blood neutrophil APE1 mRNA may be used as a marker for
this condition.
Correlation of APE1mRNA and asthma 345
Vol. 63(4): 344 - 352, 2022
El nivel de ARNm de la endonucleasa 1 apurínica/apirimidínica
en los neutrófilos de sangre periférica se asocia con el asma.
Invest Clin 2022; 63 (4): 344 – 352
Palabras clave: apurínica/apirimidínica endonucleasa; asma: mRNA; inflamación.
Resumen. La endonucleasa apurínica/apirimidínica 1 (APE1) es una
proteína clave multifuncional. Estudios recientes sugieren que APE1 está es-
trechamente asociada con la respuesta inflamatoria, pero hasta el momento
se desconoce su papel en el asma. Reclutamos a 116 pacientes con asma, in-
cluidos 50 con asma grave (NSA) y 66 con asma no grave (SA), y 140 contro-
les. Se detectó APE1 en suero usando el método ELISA. El ARNm de APE1 en
neutrófilos y eosinófilos de sangre periférica se detectó mediante ensayos de
PCR en tiempo real. En comparación con los controles sanos, observamos una
elevación significativa de los niveles séricos de ARNm de APE1 en pacientes
con asma en neutrófilos periféricos (aumento de ~1,75 veces, p<0,05) y eosi-
nófilos (aumento de ~2,2 veces, p<0,05). El ARNm de APE1 de neutrófilos de
sangre periférica puede distinguir a los pacientes asmáticos de los controles
sanos con un área bajo la curva (AUC) de 0,893 y un intervalo de confianza (IC)
del 95% de 0,847 a 0,938 (p<0,001). Además, el ARNm de APE1 puede identifi-
car el asma grave del asma no grave (AUC 0,759, IC del 95%, 0,674-0,846; p <
0,001). Sin embargo, el nivel sérico de APE1 y ARNm de eosinófilos no mostró
correlación con la incidencia y la gravedad del asma. Nuestro hallazgo confirma
la asociación entre APE1 y asma y sugiere que el ARNm de APE1 de neutrófilos
en sangre periférica puede usarse como marcador para el asma.
Received: 20-12-2021 Accepted: 13-07-2022
INTRODUCTION
Asthma is a major public health problem
worldwide. It is a multifactorial disease char-
acterized by chronic airway inflammation,
leading to bronchial hyperresponsiveness and
airway remodeling 1. Neutrophils and eosino-
phils are two major pro-inflammatory cell
types that play essential role in the pathogen-
esis of asthma 1-3. So far, few biomarkers have
been evaluated to reflect the airway inflam-
mation in the asthmatic patients, but with
unsatisfactory sensitivity or reliability.
The apurinic/apyrimidinic endonucle-
ase 1 (APE1) is a multifunctional key pro-
tein initially identified to play an important
role in the base-excision repair by recogniz-
ing the abasic site 4, 5. Besides its DNA repair
function, recent studies showed that APE1
also regulates the expression of different
transcription factors, notably, the inflam-
matory pathway regulator NF-κB, thus con-
tributing to inflammation regulation 6. It
has been proved that APE1 controls IL-6 and
IL-8 expression through its redox function 7.
APE1 also regulates inflammatory response
in macrophages and keratinocyte 8,9. Indeed,
APE1/Ref-1 has been viewed as an emerging
therapeutic target for various inflammatory
diseases, including inflammatory pain sensi-
346 Hai and Jia
Investigación Clínica 63(4): 2022
tization, murine myocarditis and spontane-
ous chronic colitis 10-12.
The association between APE1 and
asthma has not been established yet. Based
on the established association between APE1
and inflammatory diseases, we hypothesized
that APE1 may play a role in asthmatic in-
flammation. To test this notion, we detected
the serum APE1 protein expression levels,
mRAN levels from neutrophils and eosino-
phils isolated from peripheral blood in adult
asthmatic patients and healthy controls.
PATIENTS AND METHODS
Study subjects
The diagnosed asthmatic patients and
healthy controls were enrolled at the De-
partment of Respiration, Shidong Hospital
of Yangpu District between March August,
2018 and October, 2020. The diagnosis of
asthma was made in line with the criteria of
the Global Initiative for Asthma (GINA) and
described elsewhere 13. The asthmatic sub-
jects were classified as patients with severe
asthma (SA) and patients with non-severe
asthma (NSA) by the International Euro-
pean Respiratory Society/American Thora-
cic Society guidelines 14. Any patient who
had known to have underlying respiratory di-
seases other than asthma was excluded. We
also recruited sex and age matched healthy
individuals who had annual checkups at our
hospital, but did not have any acute or chro-
nic illness (such as cancer, inflammatory
diseases, cardiovascular diseases, etc.), ato-
pic diseases or any symptoms of obstructive
airway disease. The body mass index (BMI),
smoking status, asthma duration (years),
allergic history, blood eosinophils and blood
neutrophils counts were obtained from their
medical charts.
Ethical statement
The ethical committee of Shidong Hos-
pital of Yangpu District approved the study.
This research was conducted in accordance
with the principles embodied in the Declara-
tion of Helsinki. All participants were given
written informed consent forms to partici-
pate in the study.
Pulmonary function
Pulmonary function tests were per-
formed using a SYSTEM 21® device (Minato
Medical Science Co., Osaka, Japan), accord-
ing to the criteria of the American Thoracic
Society (ATS)/European Respiratory Society
and the Japanese Respiratory Society 15. The
pulmonary function was measured and in-
cluded the percentage of predicted volume
(FEV1% pred).
Serum samples collection and protein
quantification
Peripheral blood was drawn in each
participant, followed by centrifugation at
3500 rpm for 10 min to isolate serum. Se-
rum samples were collected and APE1 levels
were determined using Human APEX1 ELI-
SA kit (Cusabio, Houston, USA). The optical
density (OD) was detected with an EnSpire
microplate reader (PerkinElmer, Waltham,
USA), at a wavelength of 450 nm with a cor-
rection set at 540 nm. The concentration of
serum APE1 (pg/mL) was calculated using
the standard curve. The serum high-sensitiv-
ity C-reactive protein (Hs-CRP) was detected
using human high sensitivity C-Reactive Pro-
tein ELISA kit (Sunlong Biotech, Hangzhou,
China) according the manufacturer’s pro-
tocol. The total IgE level was detected us-
ing Human IgE ELISA Kit (Abcam Biotech,
Waltham, MA, USA) according the manufac-
turer’s protocol.
RNA isolation and reverse transcription
and real-time PCR
Neutrophils and eosinophils were iso-
lated from fresh drawn peripheral blood us-
ing the MACSxpress Whole Blood Eosinophil
Isolation Kit and MACSxpress Whole Blood
Neutrophil Isolation Kit (Miltenyi Biotec
Inc., Bergisch Gladbach, Germany), accord-
ing to the manufacturer’s manual. Total RNA
was extracted using the TaKaRa RNA PCR
Correlation of APE1mRNA and asthma 347
Vol. 63(4): 344 - 352, 2022
Kit (Takara, Dalian, China) from neutrophils
and eosinophils. The expression of APE1
mRNA was performed by quantitative real-
time polymerase chain reaction (rt-qPCR)
with the SYBR Premix Ex Taq II (Takara, Da-
lian, China). All samples were performed in
triplicate. β-actin was applied for the internal
normalization of RNA. The PCR reaction was
performed at 95°C for 3 min, followed by 40
cycles of 95°C for 10 s and 61°C for 30 s. The
comparative Ct method (ΔCt) was exploited
to calculate the relative expression levels of
miRs. The mean cycle threshold (Ct) values
and deviations between the duplicates were
calculated for all samples. The primers for
the APE1 were as following: miR-30,Forward:
CTGCTCTTGGAATGTGGATGGG, Reverse
TCCAGGCAGCTCCTGAAGTTCA. β-actin,
Forward AGAGCTACGAGCTGCCTGAC and
reverse GGATGCCACAGGACTCCA.
Statistical analysis
The data are expressed in terms of mean
(± standard deviation). Student’s t-test
and one-way ANOVA were used to compare
two or more groups. Pearson’s correlation
analysis was conducted and the correlation
coefficients (r2) were used to measure cor-
relation. A receiver operating characteristic
(ROC) curve was performed to the diagnos-
tic value of serum APE1 and its mRNA in
neutrophils and eosinophils in the discrimi-
nation between asthmatics from healthy
controls. Statistical analysis was performed
using SPSS version 19.0.0. P <0.05 was con-
sidered significant.
RESULTS
Demographic and clinical parameters
of the study subjects
We enrolled 140 healthy normal con-
trols (NC) and 116 asthmatic patients,
among which there were 50 that were as-
signed into the severe asthma (SA) group,
while 66 were patients with non-severe
asthma (NSA). There were no differences
in age, BMI and sex distribution among
the three groups. There was a higher rate
of smokes among the asthmatic patients
than in healthy controls (32.4 and 45.1 vs.
16.4%, both p<0.05). The SA group had
longer asthma duration compared to the
NSA group (9.56±4.38 vs. 14.37±8.56
years, p=0.014). The SA group had signifi-
cantly lower baseline forced expiratory vol-
ume in 1 second (FEV1; 77.23±26.45 vs.
58.34±22.25, p=0.012) compared to the
NSA group. The asthmatics had dramati-
cally elevated serum total IgE level and se-
rum hs-CRP levels than normal controls. In
addition, the SA patients had even more in-
creased total IgE level, serum hs-CRP levels
than NSA patients (Table 1).
Association between APE1 and asthma
Compared to the NC group, the serum
APE1 level in the NSA and SA group were
higher than that in control group. However,
no significant difference was noted between
the NSA and SA groups, as shown in Fig.
1A. Similarly, we found that APE1 mRNA
in peripheral blood eosinophils of NSA and
SA patients were significantly increased in
comparison to control groups. The SA group
had slightly higher eosinophil APE1 mRNA
level in contrast to NSA patients, but did
not reach statistical significance (Fig. 1B).
As for APE1 mRNA in peripheral blood neu-
trophils, we observed it was significantly up-
regulated in NSA and SA groups compared
to controls. Noticeably, the SA patients also
had a dramatically higher level of APE1 than
NSA patients (Fig. 1C).
We also performed the Pearson’s corre-
lation analysis and found that APE1 mRNA
levels of neutrophils of peripheral blood
were significantly correlated with the other
clinical indices, such as hs-CRP and Fev1%,
as shown in Table 2. The serum APE1 and
mRNA level in eosinophils are not correlat-
ed to the levels of hs-CRP and FEV1% pred.
None of the three was correlated to total Ig
E level.
348 Hai and Jia
Investigación Clínica 63(4): 2022
Diagnostic value determined by ROC
analysis
To test the diagnostic value of serum
APE1 and its mRNA in eosinophils and neu-
trophils, we performed the Receiver Operat-
ing Characteristic (ROC) curve analysis. As
shown in Fig. 2A, the peripheral blood neu-
trophil APE1 mRNA can distinguish asth-
matic patients (NSA+SA) from healthy con-
trols, at a cutoff value of 2.14, with the AUC
of 0.893 (95% CI, 0.847-0.938; p<0.001,
with 87.5% sensitivity and 84.6% specificity).
We next tested if neutrophil APE1 mRNA is
related to the asthma severity. As shown in
Fig. 2B, the APE1 mRNA at a cutoff value of
4.24, is adequate to identify SA subject from
NSA subjects, with an AUC of 0.759 (95%
CI, 0.674-0.846; p<0.001, 83.4% sensitivity
and 80.3% specificity). On the other hand,
the serum APE1 and eosinophil mRNA level,
Fig. 1A. Serum APE1 levels detected using ELISA in control, non-severe asthma (NSA) and severe asthma
(SA) groups by using the ANOVA test. Fig. 1B. APE1 mRNA in peripheral blood eosinophils using
Realtime PCR assays in control, NSA and SA groups. Fig. 1C. APE1 mRNA in peripheral blood neutro-
phils using Realtime PCR assays in control, NSA and SA groups.
Table 1
Demographic and clinical parameters of the study subjects.
Index Controls
(n=140)
NSA
(n=50)
SA
(n=66)
Age 42.43±7.23 41.45±10.31 46.63±11.45
Male (%) 51 54 48
BMI(kg/m2) 24.37±3.14 25.52±3.67 25.72±4.43
Smoking rate(%) 16.4 32.4* 45.1*#
asthma duration (years) - 9.56±4.38 14.37±8.56 #
Allergic history (%) 13 25* 27*#
Blood eosinophils( ×109/L) 0.18±0.13 0.25±0.11 0.35±0.14#
Blood neutrophils ( ×109/L) 4.11±1.04 4.44±1.23 5.67±3.14#
Serum Hs-CRP 0.45±0.01 11.12±6.67* 14.12±6.45 *#
FEV1% pred - 77.23±26.45 58.34±22.25*
Serum total IgE(IU/mL) 68.16±23.52 199.17±45.87 621.45±133.59*
BMI, Body mass index; Serum Hs-CRP, high-sensitivity C-reactive protein; FEV1% pred, forced expiratory volume
in one second % of predicted value. * vs control, p<0.05; #, vs NSA, p<0.05; SA, severe asthma; NSA, Non-severe
asthma.
Correlation of APE1mRNA and asthma 349
Vol. 63(4): 344 - 352, 2022
however, did not show a diagnostic differ-
ence in separating asthmatic patients from
controls, nor are they related to the asthma
severity (data not shown).
DISCUSSION
In this study, we detected the serum
APE1, the peripheral blood eosinophil and
neutrophil APE1 mRNA in adult asthmatic
patients and healthy controls. We found al-
though all of these markers were increased
in asthmatic patients, only neutrophil APE1
mRNA has diagnostic significance in dis-
tinguishing asthmatics from controls, and
also in separating severe patients from non-
severe patients. This finding establishes, for
the first time the association between APE1
and asthma, and also provides an easily ac-
cessible biomarker to evaluate the asthma
development and severity in a clinical set-
ting. To the best of our knowledge, we are
Fig. 2A. The Receiver-Operating Characteristic (ROC) analysis of APE1 mRNA in eosinophils of peripheral
blood in distinguishing asthmatic patients (NSA+SA) from healthy controls, with an area under the
curve value of 0.893 (95% Confidence Interval, 0.847-0.938; p < 0.001, with 87.5% sensitivity and
84.6%). Fig. 2B. The Receiver-Operating Characteristic (ROC) analyses of APE1 mRNA in eosinophils
of peripheral blood distinguishing asthmatic patients NSA from SA groups, with an area under the
curve value of 0.759 (95% Confidence Interval, 0.674-0.846; p < 0.001, 83.4% sensitivity and 80.3%
specificity.
A B
Table 2
The correlation between APE1 protein or mRNA levels with the hs-CRP, Total Ig E and FEV1%.
hs-CRP Total Ig E FEV1% pred
Serum APE1 R2=0.562, P=0.032 R2=0.223, P=0.115 R2=-0.307, P=0.055
Eosinophils APE1 mRNA R2=0.215, P=0.084 R2=0.3632, P=0.064 R2=-0.103, P=0.774
Neutrophils APE1 mRNA R2=0.775, P=0.003 R2=0.326, P=0.076 R2=-0.708, P=0.001
Serum Hs-CRP, high-sensitivity C-reactive protein; FEV1% pred, forced expiratory volume in
one second % of predicted value.
350 Hai and Jia
Investigación Clínica 63(4): 2022
the first to confirm the association between
APE1 and asthma.
APE1 has been increasingly viewed as a
potent inflammatory regulator in a variety
of inflammatory processes. In psoriatic skin,
APE1 was markedly up-regulated in epider-
mal layers. APE1 the transcriptionally acti-
vated hypoxia-inducible factor-1α and NF-κB,
two crucial transcription factors responsible
for inflammation in keratinocytes. APE1 is
essential for the expression of inflammatory
cytokines and chemokines in HaCaT cells
and primary keratinocytes 16, 17. In ApoE-
/- mouse model of atherosclerosis, plasma
APE1 correlates with Atherosclerotic Inflam-
mation levels and APE1/Ref-1 expression
was upregulated in aortic tissues 18. In mac-
rophages, pharmacological inhibition of
APE1 with its redox function inhibitor sup-
presses inflammatory response in activated
macrophages 19. Elevation of Serum APE1
was reported in experimental murine model
for myocarditis 11.
APE1 has been used as a prediction
marker of Environmental Carcinogenesis
Risk, including smoking 20. Smoking can in
induce a various types of DNA damage and
prompts cancers. Several previous studies
reported the association between genetic
variability of APE1 with lung cancer. Some
researchers reported that APE1 genotypes
were correlated with the risk of lung can-
cer among smokers 21, while the others re-
ported that APE1 polymorphisms of −656T
> G located in the promoter region and
D148E are closely associated with lung can-
cer risk under cigarette smoking exposure
22, 23. Smoking has been shown to exacerbate
asthma severity by aggravating inflamma-
tion 24, 25. Consistent with this, in our study,
we observed that the severe asthma patients
have a higher smoking status than non-se-
vere asthma and healthy controls. The smok-
ing amount is positively associated with the
asthma severity (data not shown). However,
the role of APE1 in asthma has not been elu-
cidated so far.
Our study, for the first time, confirms
the diagnostic significance of APE1 mRNA
in peripheral blood neutrophils. Airway in-
flammation in bronchial asthma is char-
acterized by infiltration with eosinophils
and neutrophils 26, 27. That was the reason
we detected APE1 mRNA levels from eo-
sinophils and neutrophils. Compared to
the sputum, human peripheral blood is a
stable source of eosinophils and neutro-
phils. Our data suggests APE1 mRNA in
peripheral blood neutrophils, rather than
that in eosinophils, can be used as a bio-
marker. Since we enrolled adult asthmat-
ics, we cannot exclude the role of eosino-
phils APE1 m RNA in asthmatic children.
To our surprise, our data did not reveal
the clinical significance of serum APE1
for asthma diagnosis and classify its se-
verity. In conclusion, our study discovered
an easily accessible biomarker for asthma
evaluation. Of course, further validation
of our finding with a larger scale of sample
size is needed.
ACKNOWLEDGEMENTS
This study was supported by a grant
from Shanghai Science and Technology
Commission (21142203600).
Conflict of interest
None.
Author’s ORCID numbers
• Qin Jia: 0000-0001-5576-9843
• Zhou Hai: 0000-0003-2815-2746
Contributions of authors
QJ conceived the study. ZH and QJ en-
rolled patients, collected patient’s informa-
tion and performed the lab assays. QJ ana-
lyzed the data and drafted manuscript.
Correlation of APE1mRNA and asthma 351
Vol. 63(4): 344 - 352, 2022
REFERENCES
1. Rosi E, Stendardi L, Binazzi B, Scano G.
Perception of airway obstruction and airway
inflammation in asthma: a review. Lung.
2006;184:251-258.
2. Parulekar AD, Diamant Z, Hanania NA.
Role of T2 inflammation biomarkers
in severe asthma. Curr Opin Pulm Med
2016;22:59-68.
3. Simpson JL, Guest M, Boggess MM, Gib-
son PG. Occupational exposures, smoking
and airway inflammation in refractory asth-
ma. BMC Pulm Med 2014;14:207.
4. Thakur S, Sarkar B, Cholia RP, Gautam N,
Dhiman M, Mantha AK. APE1/Ref-1 as an
emerging therapeutic target for various hu-
man diseases: phytochemical modulation of
its functions. Exp Mol Med 2014;46:e106.
5. Shah F, Logsdon D, Messmann RA, Fe-
hrenbacher JC, Fishel ML, Kelley MR.
Exploiting the Ref-1-APE1 node in cancer
signaling and other diseases: from bench to
clinic. NPJ Precis Oncol 2017;1.
6. McIlwain DW, Fishel ML, Boos A, Kelley
MR, Jerde TJ. APE1/Ref-1 redox-specific
inhibition decreases survivin protein levels
and induces cell cycle arrest in prostate
cancer cells. Oncotarget 2018;9:10962-
10977.
7. Xie JY, Li MX, Xiang DB, Mou JH, Qing
Y, Zeng LL, Yang ZZ, Guan W , Wang D.
Elevated expression of APE1/Ref-1 and its
regulation on IL-6 and IL-8 in bone marrow
stromal cells of multiple myeloma. Clin
Lymphoma Myeloma Leuk 2010;10:385-
393.
8. Deng X, Zhen P, Niu X, Dai Y, Wang Y ,
Zhou M. APE1 promotes proliferation and
migration of cutaneous squamous cell car-
cinoma. J Dermatol Sci 2020;100:67-74.
9. Hu Z, Hui B, Hou X, Liu R, Sukhanov S,
Liu X. APE1 inhibits foam cell formation
from macrophages via LOX1 suppression.
Am J Transl Res 2020;12:6559-6568.
10. Zaky A, Bouali-Benazzouz R, Favereaux
A, Tell G, Landry M. APE1/Ref-1 redox
function contributes to inflammatory pain
sensitization. Exp Neurol 2018;307:1-11.
11. Jin SA, Lim BK, Seo HJ, Kim SK, Ahn KT,
Jeon BH, Jeong JO. Elevation of Serum
APE1/Ref-1 in experimental murine myo-
carditis. Int J Mol Sci 2017;18 (12):2664
12. Sahakian L, Filippone RT, Stavely R, Rob-
inson AM, Yan XS, Abalo R, Eri R, Borns-
tein JC, Kelley MR, Nurgali K. Inhibition
of APE1/Ref-1 redox signaling alleviates in-
testinal dysfunction and damage to myen-
teric neurons in a mouse model of sponta-
neous chronic colitis. Inflamm Bowel Dis
2021;27:388-406.
13. Chen P, Zhao HT, Sun L, Lin JT, Zhang
HY, Huang SG, Zhu BY, Yin KS, Zheng JP,
Xu WB, Shen HH, Li Q, Zhong NS. [The
efficacy of half of the Global Initiative for
Asthma recommended dose of inhaled cor-
ticosteroids in the management of Chinese
asthmatics]. Zhonghua Jie He He Hu Xi Za
Zhi. 2005;28:458-463.
14. Chung KF, Wenzel SE, Brozek JL, Bush
A, Castro M, Sterk PJ, Adcock IM, Bate-
man ED, Bel EH, Bleecker ER, Boulet LP,
Brightling C, Chanez P, Dahlen SE, Djuka-
novic R, Frey U, Gaga M, Gibson P, Hamid
Q, Jajour NN, Mauad T, Sorkness RL, Tea-
gue WG. International ERS/ATS guidelines
on definition, evaluation and treatment of
severe asthma. Eur Respir J 2014;43:343-
373.
15. Nakamoto K, Watanabe M, Sada M, Inui T,
Nakamura M, Honda K, Wada H, Mikami
Y, Matsuzaki H, Horie M, Noguchi S, Ya-
mauchi Y, Koyama H, Kogane T, Kohyama
T, Takizawa H. Serum reactive oxygen me-
tabolite levels predict severe exacerbations
of asthma. PLoS One 2016;11:e0164948.
16. Tang Z, Wang Y, Wan Y, Xie Y, Li S, Tao D,
Wang C, Wu YZ, Sui JD. Apurinic/apyrimi-
dinic endonuclease 1/reduction-oxidation
effector factor-1 (APE1) regulates the ex-
pression of NLR family pyrin domain con-
taining 3 (NLRP3) inflammasome through
modulating transcription factor NF-kappaB
and promoting the secretion of inflamma-
tory mediators in macrophages. Ann Transl
Med 2021;9:145.
17. Bhakat KK, Mantha AK, Mitra S. Trans-
criptional regulatory functions of mam-
malian AP-endonuclease (APE1/Ref-1), an
essential multifunctional protein. Antioxid
Redox Signal 2009;11:621-638.
18. Lee YR, Joo HK, Lee EO, Park MS, Cho
HS, Kim S, Jin H, Jeong JO, Kim CS, Jeon
352 Hai and Jia
Investigación Clínica 63(4): 2022
BH. Plasma APE1/Ref-1 correlates with
atherosclerotic inflammation in ApoE(-/-)
mice. Biomedicines 2020;8 (9):366.
19. Jedinak A, Dudhgaonkar S, Kelley MR,
Sliva D. Apurinic/Apyrimidinic endonu-
clease 1 regulates inflammatory response in
macrophages. Anticancer Res 2011;31:379-
385.
20. Park JS, Kim HL, Kim YJ, Weon JI, Sung
MK, Chung HW, Seo YR. Human AP endonu-
clease 1: a potential marker for the predic-
tion of environmental carcinogenesis risk.
Oxid Med Cell Longev 2014;2014:730301.
21. Sandoval-Carrillo A, Mendez-Hernandez
EM, Vazquez-Alaniz F, Aguilar-Duran M,
Tellez-Valencia A, Barraza-Salas M, Cas-
tellanos-Juarez FX, Llave-Leon OL, Salas-
Pacheco JM. Polymorphisms in DNA repair
genes (APEX1, XPD, XRCC1 and XRCC3)
and risk of preeclampsia in a Mexican mesti-
zo population. Int J Mol Sci 2014;15:4273-
4283.
22. Ito H, Matsuo K, Hamajima N, Mitsudo-
mi T, Sugiura T, Saito T, Yasue T, Lee KM,
Kang D, Yoo KY, Sato S, Ueda R, Tajima
K. Gene-environment interactions between
the smoking habit and polymorphisms in
the DNA repair genes, APE1 Asp148Glu
and XRCC1 Arg399Gln, in Japanese lung
cancer risk. Carcinogenesis 2004;25:1395-
1401.
23. Agachan B, Kucukhuseyin O, Aksoy P, Tur-
na A, Yaylim I, Gormus U, Ergen A, Zeybek
U, Dalan B, Isbir T. Apurinic/apyrimidinic
endonuclease (APE1) gene polymorphisms
and lung cancer risk in relation to tobacco
smoking. Anticancer Res 2009;29:2417-
2420.
24. Guo M, Liu Y, Han X, Han F, Zhu J, Zhu
S, Chen B. Tobacco smoking aggravates
airway inflammation by upregulating en-
dothelin-2 and activating the c-Jun amino
terminal kinase pathway in asthma. Int Im-
munopharmacol 2019;77:105916.
25. Boulet LP, Lemiere C, Archambault F, Ca-
rrier G, Descary MC, Deschesnes F. Smo-
king and asthma: clinical and radiologic
features, lung function, and airway inflam-
mation. Chest 2006;129:66166-8.
26. Nabe T. Steroid-resistant asthma and neu-
trophils. Biol Pharm Bull 2020;43:31-35.
27. Caminati M, Menzella F, Guidolin L, Sen-
na G. Targeting eosinophils: severe asthma
and beyond. Drugs Context 2019;8:212587.
