ppi 201502ZU4659
This scientic digital publication is
continuance of the printed journal impresa
p-ISSN 0254-0770/ e-ISSN 2477-9377 / Legal
Deposit pp 197802ZU3
UNIVERSIDAD DEL ZULIA
An international refereed Journal
indexed by:
• SCOPUS
• SCIELO
• LATINDEX
• DOAJ
• MIAR
• REDIB
• AEROSPACE DATABASE
• CIVIL ENGINEERING ABTRACTS
• METADEX
• COMMUNICATION ABSTRACTS
• ZENTRALBLATT MATH, ZBMATH
• ACTUALIDAD IBEROAMERICANA
• BIBLAT
• PERIODICA
• REVENCYT
DE LA FACULTAD DE INGENIERÍA
REVIST
A TÉCNICAREVISTA TÉCNICA
“Post nubila phoebus”
“After the clouds, the sun”
“Post nubila phoebus”
“After the clouds, the sun”
LUZ in its 130th
anniversary
Established since
1891
LUZ in its 130th
anniversary
Established since
1891
VOLUME 44
MAY - AUGUST 2021
NUMBER 2
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021, 62-74
Bacterial biodiversity analysis in a stream with continuous
Marelis M. Ruiz
1
* , Elen B. de Souza Carvalho
2
, Bruno C. Ladeira
3
y Marcelo A. de
Oliveira
4
1
Facultad de Ingeniería, Escuela de Industrial, Universidad del Zulia, Maracaibo, C.P 4001, Venezuela
2
Laboratorio de Tecnologia de DNA, Universidade Federal do Amazonas UFAM, Manaus-AM, CEP 69067-005,
Brasil
3
Petrobras (UN-AM), Gerência de Seguranca, Meio Ambiente e Saúde CEP 69055-035, Manaus, Brasil
4
Faculdade de Tecnologia-Departamento de Engenharia de Produção, Universidade Federal do Amazonas
UFAM, Manaus-AM, CEP 69080-900, Brasil
*Contact author: marelis_ruiz@yahoo.es
Received:13/04/2020 | Accepted: 14/12/2020 | Available: 01/04/2021
Abstract
Since the beginning of its operations, the Urucu petroleum province (Petrobras, Amazonas unit – AM, Brazil) has
of its operational area. The objective of this research was to perform a study of the bacterial community existent in a
the stream were collected to totally extract their genomic DNA and subsequently utilize it as a template in the PCR using
obtained through a pyrosequencing method were analyzed using the open source software Mothur. The results obtained
from the software revealed the Acidobacteria phylum, Deltaproteobacteria class, and the Gp3 and Geobacter genus were all
Gp3
and Geobacter genus were preponderant. The richness indexes reported a percentage change (both decrease and increase)
for both communities, furthermore, these indicated that the diversity was more abundant in community 1. However, no
% of the genera were cataloged as bio-remediators. The aforementioned data represents a challenge for biotechnological
exploration in this environment, with the potential to identifying and classifying new taxonomic groups.
Keywords: Amazon, oil activity, metagenomic study, 16S rDNA gene, richness and diversity indexes.
Biodiversidad bacteriana en un riachuelo con vertido
Resumen
Desde el inicio de sus operaciones, la provincia petrolera de Urucu (Petrobras unidad Amazonas, Brasil, UN-AM) ha
investigación fue realizar un análisis de la comunidad bacteriana existente en un riachuelo (comunidad 1: antes del vertido,
comunidad 2: después del vertido). Se colectaron muestras de agua en riachuelo para extraer el DNA genómico total y usarlo
y los géneros Geobacter y Gp3, como los predominantes en comunidad 2. Los índices de riqueza presentaron variación
porcentual en ambas comunidades (disminución e incremento), siendo la diversidad más abundante en la comunidad 1. Sin
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
63
Palabras clave: actividad petrolera, Amazonia, análisis metagenómico, gen 16S rDNA, índices de riqueza y diversidad.
Introduction
The majority of the diversity in the Amazon ecosystems is represented by fungi and bacteria. In the environmental
et al., 1990), and the same
complexity represents a challenge to biotechnology. Regarding microorganisms that conduct bioremediation in contaminated
environments, these can be found widely distributed alongside in the soil and bodies of water, and which communities
normally constitute less than 1% of the entirety of the bacterial community. However, when these microorganisms are in
conjunction with hydrocarbons, their number is increased 10% (Atlas & Cerniglia, 1995). Established estimations indicate
that approximately 99% of microorganisms that exist in various natural habitats are not cultivable through traditional
cultivation methods (Amann et al., 1995). The recent advances in molecular biology, particularly in the DNA sequencing
technologies, have rendered the exhaustive research in microorganisms in various ecosystems possible (Parmar et al.,
2019) and the metagenomic analysis (genomes that are sequenced directly from an environmental sample, with no need
for cultivation and isolation of microbes in the laboratory) a valuable asset in determining more realistically the bacterial
diversity (Peixoto et al., 2011).
Amidst the Brazilian Amazon region, the Urucu petroleum province represents the only active oil & gas facility
from the Brazilian oil company, Petrobras (Amazonas operational unit - AM). Since the beginning of its operations in 1988,
Petrobras has been discarding industrial wastewater in a small water stream in the perimeter of its operational area from an
that its physicochemical parameters are within the threshold determined by the environmental guidelines from the Brazilian
o
357 (March 2005, from CONAMA, 2005).
ecosystem from the small water stream where it has discarded wastewater since it started operating. The aforementioned
evaluation is fundamental for recognizing the ecosystem biodiversity (through a taxonomic analysis) and for guaranteeing
individuals (specimens) that show to a higher or lesser extent the intrapopulation variance always present (Bicudo, 2004).
Among the various technological tools that perform taxonomical analysis, determine the richness and diversity indexes, and
a thorough DNA sequence aligner (Schloss, 2009).
The goal of this project was to perform a study of the bacterial community existent in a small water stream
and diversity indexes present in the ecosystem in question.
Experimental
Area of study
distant from the city of Manaus (straight line). The operational unit is located in the basin area of Urucu River in the eastern
side of the Solimões River in Coari county, state of Amazonas, Brazil.
Sampling and analysis procedure
discharge location and the other 4 downstream from the same location), which added up to a total of 16 l (4.2 gallons)
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
64
Ruiz et al.
bottles, 2 l of water in each. Experimental and geographical data of all the samples collection sites can be found in Table 1.
Table 1.
N° Location in the stream Code
Geographical
coordinates
Depth of sample
collection (m)
1 Center 50 m upstream P1
S 04° 51´ 40.4”
W 065° 17´ 52.7”
0.2
2 Side 50 m upstream P2
S 04° 51´ 40.4”
W 065° 17´ 52.7”
0.2
3 Center 80 m upstream P3
S 04° 51´ 40.3”
W 065° 17´ 52.8”
0.3
4 Side 80 m upstream P4
S 04° 51´ 40.3”
W 065° 17´ 52.8”
0.2
5 Center 50 m downstream P5
S 04° 51´ 40.8”
W 065° 17´ 50.8”
0.3
6 Side 50 m downstream P6
S 04° 51´ 40.8”
W 065° 17´ 50.8”
0.2
7 Center 80 m downstream P7
S 04° 51´ 40.9”
W 065° 17´ 50.4”
0.2
8 Side 80 m downstream P8
S 04° 51´ 40.9”
W 065° 17´ 50.3”
0.2
In the laboratory, all the samples were centrifuged in 50-ml Falcon
TM
tubes, then the supernatant water was
discarded up until obtaining solid material only (a minimum of 0.25 g required for each DNA extraction). An Eppendorf
TM
centrifuge model 5810R was utilized for the aforementioned process, operating at a rotation of 4,000 rpm for 10 min.
Before performing the metagenomic study of the samples, DNA extraction was conducted following the manufacturer’s
recommendations from the PowerSoil
TM
DNA Isolation Kit. (MoBio Laboratories Inc., U.S.).
Furthermore, the collected material was placed in a thermal cycler (thermal cycler model AB Applied Biosystems
Veriti
TM
which was programmed to run the following cycle for a PCR reaction chain initial denaturing at 95°C
(203°F) for 4 min, 35 denaturing cycles at 95 °C for 1 min, annealing at 59 °C (138.2 °F) for 1 min and an initial extension
primers were employed: MID1, MID2, MID3, and MID4, each of which was combined with all the samples which were
processed afterward in two different platforms, employing a pyrosequencing technique (454 Roche).
To facilitate the upcoming analysis, the samples were grouped in two communities, cataloged as follows:
- Community 1: composed from samples P1, P2, P3, and P4
- Community 2: composed from samples P5, P6, P7, and P8.
The mixture for the PCR was composed of 5 µl of DNA from each sample, 1 µl of initiator primer, 1 µl of reverse
primer, Taq DNA polymerase, and Milli-Q
TM
quintuplex PCR was used to characterize all eight samples. The combinations of initiators primers with the different samples
- Sample 1: P1 with MID1 - Sample 5: P5 with MID1
- Sample 2: P2 with MID2 - Sample 6: P6 with MID2
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
65
- Sample 3: P3 with MID3 - Sample 7: P7 with MID3
- Sample 4: P4 with MID4 - Sample 8: P8 with MID4
Table 2.
Type Specication Nucleotide sequence (5’-3’)
Reverse
primer
Lib-L B Key 16S R
CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGGGACTAC
CAGGGTATCTAAT
Forward
primers
16S-LibL-F-MID1
CCATCTCATCCCTGCGTGTCTCCGACTCAGACACGACGA
CTACTCCTACGGRAGGCAGCAG
16S-LibL-F-MID2
CCATCTCATCCCTGCGTGTTCCGACTCAGACACGTAGTAT
ACT CCTACGGRAGGCAGCAG
16S-LibL-F-MID3
CCATCTCATCCCTGCGTGTCTCCGACTCAGACACTACTCGT
ACTCCTACGGRAGGCAGCAG
16S-LibL-F-MID4
CCATCTCATCCCTGCGTGTCTCCGACTCAGACGA CACGTAT
ACTCCTACGGRAGGCAGCAG
TM
GE Healthcare), following the manufacturer recommendations (the bands were cut in segments of 500 base pairs - bp). To
company GenOne (Rio de Janeiro – RJ, Brazil) to apply the pyrosequencing method (Roche 454 platform) and to obtain more
comprehensive and high-quality results by using the open source software Mothur (version 1.34.0, February 2014) (Schloss,
2009).
Discussion and Results
As a product of the application of the pyrosequencing method (Roche 454), nucleotide sequences were obtained
Mothur (Schloss, 2009).
taxonomic analysis was carried out as follows: phylum, class, and genus.
Phyla
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
66
Ruiz et al.
Figure 1. Preponderant bacteria phyla in the communities from the water stream affected by continuous hydrocarbon
the Proteobacteria and Acidobacteria phyla (<5 %). An increment was observed in the Proteobacteria phylum in community
frequency value of <3 %. Regarding to the Acidobacteria phylum, the opposite trend was observed since community 2
suffered a decrement in its relative frequency magnitude (<2%), while in community 1, the maximum relative frequency
value reached was <4%.
the Brazilian Amazon region (Peixoto et al
environments (Zwart et al., 2002).
Classes
distribution of the predominant classes (Proteobacteria phylum was the most preponderant) in both studied communities
is represented in Figure 2.
Figure 2. Classes of Proteobacteria phylum (was the most preponderant) in the communities from the water stream
disposal.
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
67
In community 1, the most predominant class was Deltaproteobacteria (<6 %), followed by the Betaproteobacteria class (<5
Regarding the aforementioned results, Peixoto et al. (2011), discovered that the Betaproteobacteria class was the
the Amazon River, Brazil). Furthermore, Rodrigues (2011) discovered that the Alphaproteobacteria class was preponderant
in the Amazon River’s delta.
Genera
facilitate the graphical interpretation).
Figure 3.
Community 1 exhibited the highest frequency of bacteria genera. The most preponderant genera are listed, as
follows: Gp3 (<1.6 %), Geobacter and Gp1 (both <1 %) and 3_genus_incertae_sedis (<0.8 %). Alongside, in a lower proportion,
the following genera are listed, as follows: Geohtrix and Anaeromyxobacter (<0.2 %). Genera with the lowest frequency were
not displayed.
In community 2, the genera Geobacter (<1.2 %) and Gp3 (<0.5 %) were the most preponderant, followed by the
subsequent genera, as follows: Gp1 (<0.4 %), 3_genus_incertae_sedis, Anaeromyxobacter and Geothrix (all with <0.3 %).
On the one hand, it was observed that the highest proportion of non-cataloged genera is concentrated in community 1 (<31
Figure 4.
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
68
Ruiz et al.
The genus Gp3 which belongs to the Acidobacteria phylum and the Acidobacteria_Gp3 class was detected as well
Geobacter genus, which corresponds to the Proteobacteria
phylum and Deltaproteobacteria class, is strictly anaerobic and capable of degrading a diversity of organic compounds and
aromatics (Kleinstuber et al., 2012). Moreover, the Geobacter genus
(Neves, 2013). Additionally, there is a case study of the microbial community in Grangeiro River in which the Geobacter
et al., 2019).
The 3_genus_incertae_sedis genus belongs to the Verrucomicrobia phylum and subdivision 3 class. The
et al., 2008). The
Geothrix genus which belongs to the Acidobacteria phylum and Holophagae class is a strictly anaerobic organism capable
of reducing iron (Nevin and Lovley, 2002), and nitrate (Jin et al., 2015). Cannavan (2007) analyzed the bacterial diversity
in soils of the Amazon region, and sequences resulting from the study yielded frequency values lower than 31 % for the
Geothrix genus.
The Anaeromyxobacter
substrates (Sun et al., 2012), besides, it was detected in environments with a high content of organic matter and regularly
Anaeromyxobacter spp. subspecies, in the characterization of groundwater
et al.
Anaeromyxobacter genus in samples of mangrove from a petroleum basin (5 %).
Furthermore, in a study carried out in environments with heavy metal contamination, the Anaeoromyxobacter
Anaeromyxobacter sp. Fw109-5 (a metal-reducing bacterium) was
isolated from a contaminated medium, moreover, the genus demonstrated great potential for bioremediation processes
(Hwang, 2015).
The Gp1
by Etto (2011) in a community of marshes (plants that belong to the Gentianaceae family) and by Ferreira (2011) as well,
the latter author revealed the Gp1 genus as preponderant in the aquatic environment where carnivorous plants develop.
et al
et alet al
hydrocarbons, their concentration increases by 10 % from the community as a whole (Atlas and Cerniglia, 1995).
Rarefaction curve and richness and diversity indexes
as the base for the calculation of the rarefaction curve, richness, and diversity indexes of the microbial communities included
the distribution of OTU’s among the various samples.
Table 3.
Community
number
Code of
sample
N° of initial
sequences
N° of nal
sequences
N° of
“unclassied”
sequences
N° of OTU’s
1
P1 15762 10000 6682 2578
P2 6969 4000 2691 1109
P3 18652 13000 4163 1980
P4 36392 25000 9729 3709
2
P5 28664 22000 3758 1778
P6 23056 15000 4692 1895
P7 27311 21000 6153 2626
P8 16796 12000 4041 1634
OTU: operational taxonomic unit.
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
69
lower number of both categories. Despite yielding lower numbers in two categories, community 1 exhibited a higher number
higher in community 1, even when possessing a lower number of overall sequences when compared to community 2.
Rarefaction curve
A rarefaction curve is used for predicting the expected number of species (or diversity) in each sample, for a
indicate the strain resulted from the sequencing process to estimate the highest OTU’s values at a phylogenetic level. Due to
the obtainment of a curve of this nature, the comparison between samples with different intensities was possible (Ferreira,
2011).
The data used to plot the rarefaction curves of the community in this study was generated from the Mothur software
%. The rarefaction curves for both studied communities were displayed in Figure 5. Considering the number of sequences in
both communities, it was observed that despite the increase in sequences, the curves tend towards a horizontal alignment.
Figure 5.
OTU: operational taxonomic unit.
The results exhibited in Figure 5 indicate that the number of sequences generated in each library was relatively
diversity was higher in community 1, thus the OTU quantity was higher when compared to community 2.
Richness and diversity indexes
The estimation of the various bacterial richness and diversity indexes was performed through the application of the
coverage estimator) in consideration to estimate the richness index and the Shannon and Simpson indexes for diversity (97
% of similarity). The values related to the richness and diversity indexes that were based on the OTU’s were displayed in
Table 4.
The Chao1 richness index is an estimator based on the abundance of OTU’s (unique and rare ones), and its function
the observed species. The Ace method divides the observed frequencies into abundant and rare groups (Kim et al., 2017).
presented a decrease and others presented an increase despite belonging to the same community. Furthermore, there was
a contrast between samples from different communities, as discussed previously. Before performing an analysis over the
percentage variance of these indexes, a comparison between the sample results in the various sample collection points was
and riverside of the stream). The comparative analysis of the richness indexes percent variance, is exhibited in Table 5.
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
70
Ruiz et al.
Table 4. Richness and diversity indexes (97 % of similarity) of the communities from the water stream affected by
Community
number
Code of
sample
N° of nal
sequences
OTU
N°
Richness indexes Diversity indexes
Chao1 Ace Shannon Simpson
1
P1 10,000 2,578 6,169 9,829 6.62 0.005
P2 4,000 1,109 3,051 4,823 5.52 0.025
P3 13,000 1,980 4,353 6,636 5.67 0.016
P4 25,000 3,709 7,996 12,083 6.01 0.012
2
P5 22,000 1,778 4,390 7,991 3.02 0.363
P6 15,000 1,895 4,760 7,654 5.44 0.020
P7 21,000 2,626 5,975 9,407 5.20 0.057
P8 12,000 1,634 3,790 6,293 4.83 0.083
OTU: operational taxonomic unit.
Table 5. Analysis of the richness indexes percent variance for the communities from the water stream affected by
Location in the stream
Sample collection points in the stream
Richness index
Percent variance (%)
Community 1 Vs. Community 2 Chao1 Ace
Center 50 m both upstream
and downstream
P1 …. P5 28.8
ê
18.6
ê
Riverside 50 m both
upstream and downstream
P2 …. P6 56.0
é
58.7
é
Center 80 m both upstream
and downstream
P3 …. P7 37.2
é
41.7
é
Riverside 80 m both
upstream and downstream
P4 …. P8 52.6
ê
47.9
ê
ê: decrease, é: increase.
and Ace indexes of 28.8 % and 18.6 %, respectively. A similar pattern was obtained when comparing the samples P4 and
P8. Although, among the pairs P2 and P6, and P3 and P7, there was an increase of 56.0 % and 37.2 %, respectively, in the
variance (both increase and decrease in percentage) of the Chao1 and Ace indexes, it cannot be determined that the bacterial
richness was higher or lower in community 1 over community 2.
abundances of different species (Rodrigues, 2011). The results of this study (displayed in Table 4) exhibited a decrease in
the Shannon index in all the samples from community 2 when compared to the values in community 1, thus indicating that
community 1 possessed a higher diversity. In addition to measuring diversity, the Simpson index measures the dominance in
a community and the sensitivity to the changes in the abundant species. It is a practical tool used in environmental monitoring
when approaching to 1, which will indicate a higher dominance and subsequently a lower diversity (Ñique, 2010). The results
were higher (closer to 1) in community 2, which indicates a higher dominance of species in the second community and hence
a decrease in diversity. For the reason aforementioned, community 1 presented a higher diversity than community 2.
Statistical analysis
The AMOVA (analysis of molecular variance) generated from the Mothur software, is a statistical test that is analog
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
71
to the ANOVA (analysis of variance) and consists of carrying out the analysis of the molecular variance in samples. This
method is widely employed in population genetics to test the hypothesis that genetic diversity within two populations has
results generated through the Mothur software are shown in Table 6.
Table 6. Results from the AMOVA (Mothur software) of the communities from the water stream affected by continuous
Variance AMOVA
Community 1 vs. Community 2 Between groups Within groups Total
SS 127.569 138.502 26.607
df 1 6 7
MS 127.569 0.230836
Fs: 552.637
p
value
: 0.023
value
: probability.
As observed in the global comparison between both communities in this study (see Table 6), the results indicate
value
method used in Mothur software) consists of evaluating whether or not the samples (libraries) in each of the communities
in the analysis possess identical genetic structures (Schloss, 2009). The results originated from the LIBSHUFF analysis are
shown in Table 7.
Table 7. Results from LIBSHUFF analysis (Mothur software) of the communities from the water stream affected by
Community 1 Community 2
Comparison between
samples
(dCXYScore)
Probability
P
(signicance 10 %)
Comparison
between samples
(dCXYScore)
Probability
P
(signicance 10 %)
P1-P2 0.712 P5-P6 0.798
P2-P1 0.712 P6-P5 0.798
P1-P3 0.849 P5-P7 0.520
P3-P1 0.849 P7-P5 0.520
P1-P4 0.790 P5-P8 0.390
P4-P1 0.790 P8-P5 0.390
P2-P3 0.888 P6-P7 0.437
P3-P2 0.888 P7-P6 0.437
P2-P4 0.768 P6-P8 0.551
P4-P2 0.768 P8-P6 0.551
P3-P4 0.854 P7-P8 0.130
P4-P3 0.854 P8-P7 0.130
from each of the communities in the analysis (pp was calculated following the Bonferroni correction, p
P
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
72
Ruiz et al.
Conclusions
In community 1, Acidobacteria was the preponderant phylum, and Deltaproteobacteria the preponderant class,
furthermore, the genera Gp3 and Geobacter the most preponderant ones in this community in the study. Regarding community
2, Proteobacteria was the preponderant phylum, Betaproteobacteria the preponderant class, followed by Geobacter and Gp3
as the most preponderant genera.
in this study were cataloged as bioremediation agents of contaminated environments.
The richness indexes calculated in the study yielded an increment in percent variance as well as a decrement
in both communities in consideration, thus indicating that it was not possible to determine the community with a higher
richness index. Regarding the diversity index, the results from the study pointed to a higher bacterial diversity in community
between both communities (P>0.001). Similarly, the results exhibited similar genetic structures between samples of each of
the communities analyzed separately (P
The outcomes of this study represent a challenge for the biotechnological exploration and the comprehension of
the composition, richness, and diversity of the bacterial community existent in the Amazon rainforest, furthermore, they
represent the potential to identifying and classifying new taxonomic groups.
Acknowledgments
This project would never have been possible without the support and guidance of the multi-institutional Graduate
Program in Biotechnology (PPGBIOTEC) from the Federal University of Amazonas (UFAM) which provided human resources
Engineering Department from UFAM for promoting the publication of this article.
References
Alvaredo, D. A. P. (2009). Prospecção gênica e diversidade bacteriana de um consórcio degradador de óleo diesel. Dissertação.
Faculdade de Ciências Agrárias e Veterinárias. Jaboticabal, SP. Brasil.
Amann, R. I., LudwigSchleiferin situ detection of individual microbial cells
without cultivation. Microbiology Review, 59, 143-169.
Atlas, R. M., Cerniglia, C. E. (1995). Bioremediation of petroleum pollutants. Bioscience, 45, 332-338.
Bicudo, C. E. de M. (2004). Taxonomia. Biota Neotropica, 4(1), I-IIp.
Cannavan, F. S. (2007). Diversidade das comunidades bacterianas em solos de Terra Preta Antropogênica da Amazônia Central
e Oriental Piracicaba
SP. Brasil.
CONAMA. (2005). Capítulo III. Das condições e padrões de qualidade das águas. Conselho Nacional do Meio Ambiente.
Resolução No. 357, de 17 de março de 2005. Publicada no DOU No 053, de 18/03/2005, Brasilia.
Etto, R. M. (2011). Comunidades procarióticas das turfeiras dos campos de altitude paranaenses. Tese. Universidade Federal
do Paraná, Curitiba. Brasil.
Ferreira, A. J. (2011). Diversidade e estrutura da comunidade bacteriana associada às armadilhas da planta carnívora
Utricularia gibba (Lentibulariaceae) e o ambiente aquático. Dissertação. Instituto de Ciências Biomédicas, Universidade de
São Paulo. SP. Brasil.
Hatamono, M., Imachi H., Yashiro Y., Ohashi A., Harada H. (2007). Diversity of anaerobic microorganisms involved in
long-chain fatty acid degradation in methanogenic sludges as revealed by RNA-based stable isotope probing. Applied and
Environmental Microbiology, 73(13), 4119-4127.
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
73
Anaeromyxobacter
an anaerobic, metal-reducing bacterium isolated from a contaminated subsurface. Environment. Genome Announcements,
3(1), e01449-14.
(2007). Biorremediação de solos contaminados com hidrocarbonetos
aromáticos policíclicos. Ciência rural, 37(4), 1192-1201.
water. Water Res., 71, 207-218.
Microbiology Ecology, 63(3), 372-
382.
Kim, B. R., Jiwon, S., Guevarra, R, Lee, J., Kim, D., Seol, K-H., Lee, J. H, Kim, H. B. Isaacson, R. (2017). Deciphering diversity
indices for a better understanding of microbial communities. Microbiol. Biotechnol., 27(12), 2089-2093.
Kleinsteuber, S., Schleinitz K. M., Vogt C. (2012). Key players and team play: anaerobic microbial communities in hydrocarbon-
contaminated aquifers. Applied Microbiology and Biotechnology, 94(4), 851-873.
Mandri, T., Lin, J. (2007). Isolation and characterization of en Kwazulu-Natal, South Africa. African Journal of Biotechnology,
6(1), 023-027.
Neves, R. O. (2013). Caracterização da microbiota bacteriana da água do Rio Negro em diferentes períodos sazonais.
Dissertação. Universidade Federal do Amazonas UFAM, AM, Brasil.
Nevin, K., Lovley, D. R. (2002). Mechanisms for accessing insoluble Fe(III) oxide during dissimilatory Fe(III) reduction by
Geothrix fermentans. Applied and Environmental Microbiology, 68(5), 2294-2299.
Ñique, M. (2010). Biodiversidad: Clasificación y cuantificación. Universidad Nacional Agrária de la Selva. Tingo María, Perú.
Aquatic
Microbial Ecology, 48, 231-240.
Nústez C., Paredes D., Cubillos. J. (2014). Biorremediación para la degradación de hidrocarburos totales presentes en los
sedimentos de una estación de servicio de combustible. Rev. Téc. Ing. Univ. Zulia, 37(1), 20-28.
Parmar S., Sharma, V. K., Kumar, J. (2019). Aplication of molecular and sequencing techniques in analysis of microbial diversity
in agroecosystem. In: Microbial Genomics in Sustainable Agroecosystems, Ed. Tripathi, V., Kumar, P., Tripathi, P., Kishore, A.,
Kamle. M. Singapore: Springer.
and Negro River tributaries of the Amazon River based on small subunit rRNA gene sequences. Genetics and Molecular
Research, 10(4), 3783-3793.
of cellulose degrading, fermentative, and sulfate-reducing Bacteria and methanogenic Archaea. Applied and Environmental
Microbiology, 76(7), 2192-2202.
Ramos, D. T. (2013). Bioestimulação de processos metanogênicos com acetato de amônio para degradação acelerada de
hidrocarbonetos de petróleo em águas subterrâneas contaminadas com diesel B20. Tese. Universidade Federal de Santa
Catarina. Florianópolis, SC. Brasil.
Rodrigues, T. B. (2011). Diversidade metagênomica microbiana de biomas terrestres e marinhos. Tese. Universidade Federal
de Rio de Janeiro, RJ. Brasil.
Schloss, P. D. (2009). A high-throughput DNA sequence aligner for microbial ecology studies. PLoS ONE, 4, 8230.
International Journal of Environmental
Research, and Public Health, 6, 278-309.
Silva, C. L. V., Silva A. L. S, De Medeiros, S. R. B., Lima L. F., Blaha C. A. G. (2007). Detecção de bacterias redutoras de Fe (III), em
mangue da bacia petrolífera Portiguar com potencial biodegradador de petróleo. 4° PDPETRO. Campinas, SP. Brasil.
Rev. Téc. Ing. Univ. Zulia. Vol. 44, No. 2, May-August, 2021.
74
Ruiz et al.
treatment plant samples by stable isotope probing. Applied and Environmental Microbiology, 78(8), 2973-2980.
of soil bacteria. Appl. Environ. Microbiol., 56(3), 776-781.
Toyama, D. (2012). Análise da diversidade microbiana aquática em rios e lagos da região amazônica. Dissertação. Universidade
de São Paulo, SP. Brasil.
diversity and heavy metal resistance genes of a microbial community on contaminated environment. Applied Geochemistry,
105, 1-6.
Zwart, G., Zwart, G., Crump, B. C., Agterveld, M. P. K. V., Hagen, F., Han, S. K. (2002). Typical freshwater bacteria: an analysis of
Aquatic Microbiol. Ecol., 28, 141-155.
REVISTA TECNICA
www.luz.edu.ve
www.serbi.luz.edu.ve
www.produccioncienticaluz.org
OF THE FACULTY OF ENGINEERING
UNIVERSIDAD DEL ZULIA
This Journal was edited and published in digital format
on April 2021 by Serbiluz Editorial Foundation
Vol. 44. N°2, May - August, 2021__________________________
